Incidental Mutation 'R4468:Ifit1bl2'
ID329298
Institutional Source Beutler Lab
Gene Symbol Ifit1bl2
Ensembl Gene ENSMUSG00000067297
Gene Nameinterferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms2010002M12Rik
MMRRC Submission 041725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4468 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34617049-34640743 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 34619068 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 383 (Q383*)
Ref Sequence ENSEMBL: ENSMUSP00000108082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect probably null
Transcript: ENSMUST00000087357
AA Change: Q383*
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297
AA Change: Q383*

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112463
AA Change: Q383*
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297
AA Change: Q383*

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat A T 11: 116,596,955 D160V possibly damaging Het
Abca2 A G 2: 25,444,902 Y1962C probably damaging Het
Adgrv1 T A 13: 81,374,256 M5921L probably benign Het
Bmp2 T C 2: 133,554,454 V10A probably benign Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccdc33 G T 9: 58,069,872 T282K possibly damaging Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Clec4f A G 6: 83,652,433 I381T probably damaging Het
Fam213b T G 4: 154,897,050 K190T probably benign Het
Igkv6-15 A G 6: 70,406,973 V7A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Mum1 C T 10: 80,240,736 probably benign Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr155 G A 4: 43,854,737 V143M probably benign Het
Olfr847 C T 9: 19,375,648 V78I probably benign Het
Pcdha5 T C 18: 36,962,180 S581P probably benign Het
Phf10 T C 17: 14,952,775 probably null Het
Ppp2r3c C T 12: 55,297,883 W100* probably null Het
Rad9a G A 19: 4,200,294 H143Y probably benign Het
Riox2 T A 16: 59,475,994 probably benign Het
Ros1 T A 10: 52,118,356 Y1276F probably damaging Het
Rps12-ps24 A G 8: 36,026,114 noncoding transcript Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a G A 9: 119,754,987 L1521F probably damaging Het
Shoc2 A G 19: 54,026,414 Y346C probably damaging Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Spag17 A T 3: 100,085,366 D1726V probably damaging Het
Tns4 A T 11: 99,070,415 C646S probably benign Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Wls C A 3: 159,872,927 A42E probably damaging Het
Other mutations in Ifit1bl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ifit1bl2 APN 19 34619919 missense probably benign 0.22
IGL00706:Ifit1bl2 APN 19 34618882 missense probably benign 0.09
IGL01322:Ifit1bl2 APN 19 34619004 missense probably benign 0.10
IGL01362:Ifit1bl2 APN 19 34619484 missense probably benign 0.04
IGL03061:Ifit1bl2 APN 19 34619724 missense probably benign 0.41
R0039:Ifit1bl2 UTSW 19 34619446 nonsense probably null
R1079:Ifit1bl2 UTSW 19 34619485 missense probably benign 0.00
R1438:Ifit1bl2 UTSW 19 34619169 missense possibly damaging 0.70
R2050:Ifit1bl2 UTSW 19 34619470 missense possibly damaging 0.75
R2104:Ifit1bl2 UTSW 19 34619520 missense probably benign 0.01
R2228:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R2229:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R4517:Ifit1bl2 UTSW 19 34629764 start gained probably benign
R5723:Ifit1bl2 UTSW 19 34620058 missense probably benign 0.07
R5935:Ifit1bl2 UTSW 19 34619728 missense probably benign 0.04
R6024:Ifit1bl2 UTSW 19 34620038 missense probably benign 0.00
R6083:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6085:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6280:Ifit1bl2 UTSW 19 34620134 missense possibly damaging 0.70
R6368:Ifit1bl2 UTSW 19 34619125 missense probably benign 0.00
R6905:Ifit1bl2 UTSW 19 34619590 missense possibly damaging 0.90
R7048:Ifit1bl2 UTSW 19 34619151 missense probably benign 0.04
R7355:Ifit1bl2 UTSW 19 34619661 missense probably damaging 1.00
R7447:Ifit1bl2 UTSW 19 34619574 missense probably damaging 1.00
R7661:Ifit1bl2 UTSW 19 34619028 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATGGCTTCACTTGTGTCCC -3'
(R):5'- GCAGACCAATCATGCCATTTGG -3'

Sequencing Primer
(F):5'- GTCCCCTCTCAGTCTGCAGAC -3'
(R):5'- GAGCTGAAACCCACATATG -3'
Posted On2015-07-21