Incidental Mutation 'R4469:Nostrin'
ID329305
Institutional Source Beutler Lab
Gene Symbol Nostrin
Ensembl Gene ENSMUSG00000034738
Gene Namenitric oxide synthase trafficker
SynonymsmDaIP2
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69135800-69189330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 69175717 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 248 (I248M)
Ref Sequence ENSEMBL: ENSMUSP00000036923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041865]
Predicted Effect probably damaging
Transcript: ENSMUST00000041865
AA Change: I248M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: I248M

DomainStartEndE-ValueType
Pfam:FCH 13 88 4.9e-12 PFAM
low complexity region 135 146 N/A INTRINSIC
coiled coil region 160 190 N/A INTRINSIC
coiled coil region 305 334 N/A INTRINSIC
low complexity region 419 439 N/A INTRINSIC
SH3 441 496 8.89e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141276
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Nostrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nostrin APN 2 69185554 splice site probably benign
IGL00502:Nostrin APN 2 69183992 missense probably benign
IGL00767:Nostrin APN 2 69175775 missense probably benign 0.00
IGL00846:Nostrin APN 2 69185555 splice site probably benign
IGL00912:Nostrin APN 2 69182819 splice site probably benign
IGL02123:Nostrin APN 2 69156109 splice site probably benign
IGL02213:Nostrin APN 2 69183918 missense probably benign 0.25
R0295:Nostrin UTSW 2 69179416 missense probably benign 0.19
R0543:Nostrin UTSW 2 69189131 makesense probably null
R1384:Nostrin UTSW 2 69189062 missense probably benign 0.05
R1501:Nostrin UTSW 2 69158785 missense probably damaging 1.00
R1632:Nostrin UTSW 2 69175734 missense probably benign 0.21
R2012:Nostrin UTSW 2 69144767 splice site probably null
R2140:Nostrin UTSW 2 69166003 missense probably damaging 0.98
R2159:Nostrin UTSW 2 69180922 splice site probably null
R2329:Nostrin UTSW 2 69161094 missense probably damaging 1.00
R2890:Nostrin UTSW 2 69180905 missense probably benign
R4607:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4608:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4684:Nostrin UTSW 2 69183924 missense probably benign 0.00
R4719:Nostrin UTSW 2 69144812 nonsense probably null
R4846:Nostrin UTSW 2 69175579 missense probably damaging 1.00
R4911:Nostrin UTSW 2 69161142 missense possibly damaging 0.87
R4987:Nostrin UTSW 2 69156431 missense probably benign
R5054:Nostrin UTSW 2 69175713 missense possibly damaging 0.82
R5177:Nostrin UTSW 2 69175754 missense possibly damaging 0.83
R6561:Nostrin UTSW 2 69180857 missense probably benign
R6785:Nostrin UTSW 2 69183927 missense probably benign 0.01
R6789:Nostrin UTSW 2 69175512 missense probably benign
R7453:Nostrin UTSW 2 69183896 missense possibly damaging 0.95
R7465:Nostrin UTSW 2 69185507 missense possibly damaging 0.93
R7570:Nostrin UTSW 2 69175806 missense probably damaging 0.98
R7761:Nostrin UTSW 2 69161122 missense possibly damaging 0.88
R7802:Nostrin UTSW 2 69189012 missense probably benign 0.18
R8115:Nostrin UTSW 2 69180920 critical splice donor site probably null
R8160:Nostrin UTSW 2 69179466 missense probably damaging 0.98
X0021:Nostrin UTSW 2 69144792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATTCTCTTCAGAGCATGCTGG -3'
(R):5'- GCCTGACTTCTCAATACGTGG -3'

Sequencing Primer
(F):5'- CTTCAGAGCATGCTGGAGCTG -3'
(R):5'- CTTCTCAATACGTGGCCAAGATGAG -3'
Posted On2015-07-21