Incidental Mutation 'R4469:Dnmt3c'
ID329307
Institutional Source Beutler Lab
Gene Symbol Dnmt3c
Ensembl Gene ENSMUSG00000082079
Gene NameDNA methyltransferase 3C
Synonyms
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153696652-153729907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153720360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 555 (T555A)
Ref Sequence ENSEMBL: ENSMUSP00000153622 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000119996
AA Change: T555A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.7398 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU or endonuclease-mediated mutation alleles exhibit reduced transposon and retrotransposons in male germ cells, male infertility, meiotic arrest, azoospermia and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Dnmt3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0479:Dnmt3c UTSW 2 153714941 splice site probably null
R1167:Dnmt3c UTSW 2 153711781 critical splice donor site probably null
R6198:Dnmt3c UTSW 2 153720009 missense noncoding transcript
R6561:Dnmt3c UTSW 2 153720030 missense probably damaging 1.00
R7030:Dnmt3c UTSW 2 153717425 missense probably damaging 1.00
R7135:Dnmt3c UTSW 2 153714952 splice site probably null
R7296:Dnmt3c UTSW 2 153715026 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCTTAGGCCTCAGGAAGATG -3'
(R):5'- GCCAACATGGACTATCTGGC -3'

Sequencing Primer
(F):5'- AGCGAACAATGCTCTGCTG -3'
(R):5'- ATGGACTATCTGGCCCAAGCAG -3'
Posted On2015-07-21