Mutagenetix > Incidental Mutations

Incidental Mutation 'R4469:Csf1'

329310

Institutional Source

Beutler Lab

Gene Symbol

Csf1

Ensembl Gene

ENSMUSG00000014599

Gene Name

colony stimulating factor 1 (macrophage)

Synonyms

colony-stimulating factor-1, CSF-1, Csfm, M-CSF

MMRRC Submission

041726-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.791) question?

Stock #

R4469 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107741048-107760469 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 107750681 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]

Predicted Effect

probably benign
Transcript: ENSMUST00000014743

SMART Domains

Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118593

SMART Domains

Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	257	9.5e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120243

SMART Domains

Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000120654

SMART Domains

Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	31	163	1.7e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153114

SMART Domains

Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	26	182	1.1e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155557

Predicted Effect

probably null
Transcript: ENSMUST00000156820

SMART Domains

Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	15	142	6e-37	PFAM
Pfam:CSF-1	160	279	4.9e-52	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	A	G	13: 58,382,425	L257P	probably damaging	Het
4833420G17Rik	A	G	13: 119,469,809	K196E	probably damaging	Het
Ackr1	T	C	1: 173,332,545		probably null	Het
Adgra1	C	T	7: 139,876,061	T535I	probably damaging	Het
Ankrd11	A	G	8: 122,896,587	Y310H	probably damaging	Het
Arhgef5	T	C	6: 43,275,099	I928T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asb4	C	A	6: 5,423,409	F185L	probably benign	Het
Ces2g	A	T	8: 104,965,970	I301F	probably benign	Het
Chd1	T	C	17: 15,760,395	I1308T	probably damaging	Het
Cntnap4	A	T	8: 112,665,266	N121I	probably damaging	Het
Dnah7a	T	A	1: 53,444,526	H3364L	probably benign	Het
Dnmt3c	A	G	2: 153,720,360	T555A	possibly damaging	Het
Dst	A	G	1: 34,191,842	T3017A	probably benign	Het
Efcab7	A	G	4: 99,909,704	D482G	possibly damaging	Het
Fbxl5	A	G	5: 43,768,186	V154A	probably damaging	Het
Flt3	T	C	5: 147,375,644		silent	Het
G6pd2	A	T	5: 61,808,945	Y21F	probably benign	Het
Gm9376	C	T	14: 118,267,599	P148S	probably damaging	Het
Gpsm1	G	A	2: 26,319,831		probably benign	Het
Gtpbp2	A	G	17: 46,161,313	Y58C	probably damaging	Het
Hcrtr2	T	A	9: 76,230,556	T426S	probably benign	Het
Herc3	T	A	6: 58,876,809	Y613*	probably null	Het
Hsd17b1	A	T	11: 101,080,012	M265L	probably benign	Het
Ier3ip1	A	G	18: 76,940,598		probably benign	Het
Kif11	A	G	19: 37,416,492	M924V	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lancl2	T	A	6: 57,713,034	L75H	probably damaging	Het
Mfsd4b1	T	C	10: 40,012,095		probably benign	Het
Nlrc5	A	T	8: 94,520,839	I1588F	probably damaging	Het
Nostrin	C	G	2: 69,175,717	I248M	probably damaging	Het
Olfr104-ps	A	G	17: 37,362,637	I170M	possibly damaging	Het
Olfr125	T	C	17: 37,835,716	L239P	probably benign	Het
Rabggta	A	G	14: 55,716,487	V266A	probably benign	Het
Ror2	G	A	13: 53,131,980	T66M	possibly damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Skp1a	C	T	11: 52,245,078	T138I	probably benign	Het
Smad9	T	C	3: 54,782,761	V134A	probably damaging	Het
Snx29	T	A	16: 11,420,701		probably null	Het
Sos1	A	G	17: 80,453,811	I152T	probably damaging	Het
Ssbp2	G	A	13: 91,694,056	G302D	probably damaging	Het
Stom	T	C	2: 35,321,533	N159D	possibly damaging	Het
Trav16d-dv11	A	G	14: 53,047,578	K37R	probably benign	Het
Trim75	A	G	8: 64,983,717	V27A	probably damaging	Het
Ttn	T	C	2: 76,717,761	T32066A	probably damaging	Het
Txndc11	T	C	16: 11,075,223	H881R	probably benign	Het
Ubp1	C	T	9: 113,958,707	T222I	probably benign	Het
Unc5cl	C	G	17: 48,459,805	P69R	possibly damaging	Het
Zfp616	T	A	11: 74,071,124	C24S	probably damaging	Het

Other mutations in Csf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Csf1	APN	3	107756727	missense	probably benign	0.00
IGL00907:Csf1	APN	3	107750346	missense	probably damaging	1.00
IGL01644:Csf1	APN	3	107753842	missense	possibly damaging	0.84
R0022:Csf1	UTSW	3	107753862	missense	probably damaging	0.99
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0350:Csf1	UTSW	3	107748606	missense	probably benign	0.01
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1531:Csf1	UTSW	3	107748338	missense	possibly damaging	0.72
R1897:Csf1	UTSW	3	107748279	missense	probably damaging	1.00
R4373:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4375:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4376:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4377:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4474:Csf1	UTSW	3	107753856	missense	probably damaging	0.98
R4604:Csf1	UTSW	3	107756962	splice site	probably null
R4634:Csf1	UTSW	3	107749167	missense	probably damaging	0.96
R5086:Csf1	UTSW	3	107748710	missense	possibly damaging	0.72
R5156:Csf1	UTSW	3	107748936	missense	probably benign	0.01
R5425:Csf1	UTSW	3	107748896	missense	possibly damaging	0.96
R6120:Csf1	UTSW	3	107753854	missense	probably damaging	0.96
R6268:Csf1	UTSW	3	107747157	missense	possibly damaging	0.86
R6269:Csf1	UTSW	3	107749001	missense	probably benign	0.04
R6273:Csf1	UTSW	3	107749163	missense	probably damaging	1.00
R6298:Csf1	UTSW	3	107748359	missense	possibly damaging	0.96
R7196:Csf1	UTSW	3	107753898	missense	possibly damaging	0.91
R7375:Csf1	UTSW	3	107748179	missense	possibly damaging	0.96
R7437:Csf1	UTSW	3	107750756	missense	probably benign	0.00
R7464:Csf1	UTSW	3	107748875	missense	probably benign	0.03
R7780:Csf1	UTSW	3	107750393	missense	probably damaging	0.96
R7808:Csf1	UTSW	3	107760045	missense	possibly damaging	0.70
R8153:Csf1	UTSW	3	107748704	missense	probably damaging	0.98
R8765:Csf1	UTSW	3	107756675	missense	probably benign	0.33
Z1177:Csf1	UTSW	3	107749080	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- AAAGTTCGGACACAGGCCTG -3'
(R):5'- AGCTGTTCCTTTGGAGATCTTC -3'

Sequencing Primer
(F):5'- GTAAGCATGAACATTGGGCTACCTC -3'
(R):5'- GAGATCTTCTCCCTGGGCC -3'

Posted On

2015-07-21