Incidental Mutation 'R4469:Efcab7'
ID329311
Institutional Source Beutler Lab
Gene Symbol Efcab7
Ensembl Gene ENSMUSG00000073791
Gene NameEF-hand calcium binding domain 7
Synonyms
MMRRC Submission 041726-MU
Accession Numbers

Genbank: NM_145549; MGI: 2385199

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location99829198-99912788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99909704 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 482 (D482G)
Ref Sequence ENSEMBL: ENSMUSP00000095572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097959] [ENSMUST00000136874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097959
AA Change: D482G

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095572
Gene: ENSMUSG00000073791
AA Change: D482G

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
SCOP:d2pvba_ 339 408 2e-4 SMART
Blast:EFh 348 376 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123830
Predicted Effect probably benign
Transcript: ENSMUST00000136874
AA Change: D42G

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Efcab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Efcab7 APN 4 99831463 missense probably benign 0.12
3-1:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0023:Efcab7 UTSW 4 99901637 splice site probably benign
R0085:Efcab7 UTSW 4 99904680 unclassified probably benign
R0122:Efcab7 UTSW 4 99892363 splice site probably benign
R0326:Efcab7 UTSW 4 99831394 missense possibly damaging 0.86
R0382:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0410:Efcab7 UTSW 4 99878285 critical splice donor site probably null
R0413:Efcab7 UTSW 4 99909746 missense probably damaging 1.00
R0611:Efcab7 UTSW 4 99901689 missense probably damaging 1.00
R0689:Efcab7 UTSW 4 99904784 missense probably damaging 1.00
R1114:Efcab7 UTSW 4 99878250 nonsense probably null
R1459:Efcab7 UTSW 4 99912547 missense probably null 1.00
R1722:Efcab7 UTSW 4 99900618 missense probably benign 0.36
R1932:Efcab7 UTSW 4 99911018 missense probably damaging 1.00
R1954:Efcab7 UTSW 4 99900690 missense probably damaging 1.00
R2305:Efcab7 UTSW 4 99831481 missense possibly damaging 0.95
R2358:Efcab7 UTSW 4 99831586 unclassified probably benign
R2845:Efcab7 UTSW 4 99909638 missense probably damaging 0.99
R3915:Efcab7 UTSW 4 99878173 missense probably damaging 0.98
R4686:Efcab7 UTSW 4 99878116 missense probably benign 0.29
R4737:Efcab7 UTSW 4 99831568 nonsense probably null
R4970:Efcab7 UTSW 4 99831543 missense probably damaging 1.00
R5120:Efcab7 UTSW 4 99897491 missense probably damaging 1.00
R5264:Efcab7 UTSW 4 99878170 missense probably benign 0.27
R5366:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R5901:Efcab7 UTSW 4 99909744 missense probably damaging 0.99
R6255:Efcab7 UTSW 4 99829390 unclassified probably benign
R6438:Efcab7 UTSW 4 99909772 missense probably benign 0.39
R6451:Efcab7 UTSW 4 99831501 nonsense probably null
R6717:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R6766:Efcab7 UTSW 4 99877959 frame shift probably null
R6855:Efcab7 UTSW 4 99900580 nonsense probably null
R6865:Efcab7 UTSW 4 99912596 missense probably damaging 1.00
R7868:Efcab7 UTSW 4 99888957 missense probably benign 0.01
R7893:Efcab7 UTSW 4 99888861 missense probably damaging 1.00
R8069:Efcab7 UTSW 4 99829378 missense unknown
R8787:Efcab7 UTSW 4 99900594 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- AAATTTACCAGGAGGCTAATCCAAG -3'
(R):5'- GGTATTTGGCTGCAATATAAGAAGG -3'

Sequencing Primer
(F):5'- CCAGGAGGCTAATCCAAGATTTTG -3'
(R):5'- GGAAAGCTACCACATAATCAATACC -3'
Posted On2015-07-21