Incidental Mutation 'R4469:Arhgef5'
ID329315
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene NameRho guanine nucleotide exchange factor (GEF) 5
Synonyms2210412D05Rik
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43265582-43289320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43275099 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 928 (I928T)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: I928T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I928T

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: I196T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATACATTCAGGAGGTCAAGCC -3'
(R):5'- TGGATGCCTTCTCCAGTTGG -3'

Sequencing Primer
(F):5'- TTCAGGAGGTCAAGCCAAGCC -3'
(R):5'- CCAGTTGGTGGTGGAGGG -3'
Posted On2015-07-21