Incidental Mutation 'R4469:Ces2g'
ID329323
Institutional Source Beutler Lab
Gene Symbol Ces2g
Ensembl Gene ENSMUSG00000031877
Gene Namecarboxylesterase 2G
Synonyms2210023G05Rik
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104961718-104969537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104965970 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 301 (I301F)
Ref Sequence ENSEMBL: ENSMUSP00000049315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043183]
Predicted Effect probably benign
Transcript: ENSMUST00000043183
AA Change: I301F

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049315
Gene: ENSMUSG00000031877
AA Change: I301F

DomainStartEndE-ValueType
Pfam:COesterase 11 539 1.4e-176 PFAM
Pfam:Abhydrolase_3 144 245 4.9e-11 PFAM
Pfam:Peptidase_S9 159 331 8.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212330
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Ces2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ces2g APN 8 104967839 splice site probably benign
IGL00901:Ces2g APN 8 104965129 missense probably benign 0.01
IGL02101:Ces2g APN 8 104965137 splice site probably null
IGL02146:Ces2g APN 8 104966944 missense possibly damaging 0.94
IGL02624:Ces2g APN 8 104964748 missense probably damaging 1.00
IGL03091:Ces2g APN 8 104964754 missense probably damaging 1.00
PIT4810001:Ces2g UTSW 8 104964889 missense possibly damaging 0.52
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0122:Ces2g UTSW 8 104968300 missense probably damaging 0.96
R0494:Ces2g UTSW 8 104966567 missense probably benign
R1127:Ces2g UTSW 8 104967462 splice site probably null
R1337:Ces2g UTSW 8 104963965 missense possibly damaging 0.63
R1619:Ces2g UTSW 8 104967352 missense probably damaging 1.00
R1813:Ces2g UTSW 8 104966937 missense probably benign 0.32
R2240:Ces2g UTSW 8 104962502 missense probably benign 0.11
R2255:Ces2g UTSW 8 104967414 missense probably damaging 1.00
R2307:Ces2g UTSW 8 104968412 missense probably benign 0.01
R2566:Ces2g UTSW 8 104965989 critical splice donor site probably null
R4026:Ces2g UTSW 8 104964745 missense probably damaging 0.99
R4631:Ces2g UTSW 8 104967462 splice site probably null
R4859:Ces2g UTSW 8 104967462 splice site probably null
R4900:Ces2g UTSW 8 104967357 nonsense probably null
R4925:Ces2g UTSW 8 104964894 missense probably benign 0.27
R5524:Ces2g UTSW 8 104966895 missense probably benign 0.00
R5556:Ces2g UTSW 8 104967442 missense probably benign 0.14
R6795:Ces2g UTSW 8 104967817 missense probably damaging 0.96
R6988:Ces2g UTSW 8 104963908 missense probably benign
R7653:Ces2g UTSW 8 104962653 missense probably damaging 1.00
R7724:Ces2g UTSW 8 104966852 missense probably benign 0.02
R7740:Ces2g UTSW 8 104966330 missense probably damaging 0.98
R7856:Ces2g UTSW 8 104966382 missense not run
R8123:Ces2g UTSW 8 104966923 missense probably benign 0.06
R8690:Ces2g UTSW 8 104966973 missense probably benign 0.01
R8724:Ces2g UTSW 8 104966323 missense probably benign 0.01
R8732:Ces2g UTSW 8 104962563 missense possibly damaging 0.78
Z1177:Ces2g UTSW 8 104963961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGGATGTCACCTTTGAGC -3'
(R):5'- CACCCTGGAGGAGAATCTACAC -3'

Sequencing Primer
(F):5'- CTGGATGTCACCTTTGAGCAATAG -3'
(R):5'- CAAAGGCATACAGATGAGGT -3'
Posted On2015-07-21