Incidental Mutation 'R4469:Mfsd4b1'
ID329328
Institutional Source Beutler Lab
Gene Symbol Mfsd4b1
Ensembl Gene ENSMUSG00000038522
Gene Namemajor facilitator superfamily domain containing 4B1
SynonymsAI317395
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4469 (G1)
Quality Score132
Status Validated
Chromosome10
Chromosomal Location40001575-40025268 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 40012095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163705]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099956
Predicted Effect probably benign
Transcript: ENSMUST00000163705
SMART Domains Protein: ENSMUSP00000128324
Gene: ENSMUSG00000038522

DomainStartEndE-ValueType
Pfam:MFS_1 1 369 1.9e-15 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214611
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Mfsd4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Mfsd4b1 APN 10 40003119 missense probably benign 0.16
IGL03356:Mfsd4b1 APN 10 40002831 missense probably damaging 0.97
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1770:Mfsd4b1 UTSW 10 40003227 missense probably damaging 0.99
R1930:Mfsd4b1 UTSW 10 40006074 missense probably benign 0.01
R2122:Mfsd4b1 UTSW 10 40002651 missense possibly damaging 0.91
R2290:Mfsd4b1 UTSW 10 40003331 missense probably damaging 0.99
R3508:Mfsd4b1 UTSW 10 40002719 missense probably benign 0.15
R4594:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R5300:Mfsd4b1 UTSW 10 40003031 missense probably benign
R6250:Mfsd4b1 UTSW 10 40003110 missense possibly damaging 0.92
R6426:Mfsd4b1 UTSW 10 40006077 missense possibly damaging 0.95
R7061:Mfsd4b1 UTSW 10 40003386 missense possibly damaging 0.83
R7595:Mfsd4b1 UTSW 10 40003225 nonsense probably null
R7734:Mfsd4b1 UTSW 10 40007378 missense probably damaging 0.98
R7737:Mfsd4b1 UTSW 10 40003278 missense probably damaging 0.97
R7852:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7893:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R7935:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7976:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
X0063:Mfsd4b1 UTSW 10 40007307 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCTTTCCACATGGCAAAG -3'
(R):5'- CTAAGCAGTTGGTGGTGCAG -3'

Sequencing Primer
(F):5'- GTGGAGACTGTTGCCATCAATGAC -3'
(R):5'- CAGGATGCATTGCTGACAATC -3'
Posted On2015-07-21