Incidental Mutation 'R4469:Skp1a'
ID329329
Institutional Source Beutler Lab
Gene Symbol Skp1a
Ensembl Gene ENSMUSG00000036309
Gene NameS-phase kinase-associated protein 1A
Synonyms2610043E24Rik, Tceb1l, p19Skp1, 2610206H23Rik
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location52231995-52246858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52245078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 138 (T138I)
Ref Sequence ENSEMBL: ENSMUSP00000104700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037324] [ENSMUST00000109072] [ENSMUST00000116595] [ENSMUST00000147684] [ENSMUST00000166537]
Predicted Effect probably benign
Transcript: ENSMUST00000037324
AA Change: T138I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038744
Gene: ENSMUSG00000036309
AA Change: T138I

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109072
AA Change: T138I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104700
Gene: ENSMUSG00000036309
AA Change: T138I

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116595
SMART Domains Protein: ENSMUSP00000112294
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 1 28 6.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147684
SMART Domains Protein: ENSMUSP00000129711
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 2 47 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166537
AA Change: T90I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131833
Gene: ENSMUSG00000036309
AA Change: T90I

DomainStartEndE-ValueType
Skp1 1 64 1.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Skp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Skp1a UTSW 11 52243765 intron probably benign
R1004:Skp1a UTSW 11 52237380 intron probably benign
R1710:Skp1a UTSW 11 52242615 missense probably benign 0.00
R2250:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4468:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4592:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4976:Skp1a UTSW 11 52243631 missense probably benign 0.01
R5576:Skp1a UTSW 11 52242588 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCTAGTGAAAGGTGAAACTACATTG -3'
(R):5'- CAAGGAAATTTTAAAGGTGTTCTCGGG -3'

Sequencing Primer
(F):5'- CAGTATTACAGGGCAGAGAATTTC -3'
(R):5'- TGTTCTCGGGTAAGCAGCAC -3'
Posted On2015-07-21