Incidental Mutation 'R4469:2210016F16Rik'
ID329333
Institutional Source Beutler Lab
Gene Symbol 2210016F16Rik
Ensembl Gene ENSMUSG00000021550
Gene NameRIKEN cDNA 2210016F16 gene
Synonyms
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58379817-58385225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58382425 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 257 (L257P)
Ref Sequence ENSEMBL: ENSMUSP00000022032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022032]
Predicted Effect probably damaging
Transcript: ENSMUST00000022032
AA Change: L257P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022032
Gene: ENSMUSG00000021550
AA Change: L257P

DomainStartEndE-ValueType
low complexity region 31 41 N/A INTRINSIC
Pfam:Q_salvage 53 338 9.7e-122 PFAM
Meta Mutation Damage Score 0.5529 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Rabggta A G 14: 55,716,487 V266A probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in 2210016F16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:2210016F16Rik APN 13 58381976 missense probably damaging 1.00
IGL02302:2210016F16Rik APN 13 58381935 missense probably damaging 1.00
PIT1430001:2210016F16Rik UTSW 13 58385013 nonsense probably null
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R2874:2210016F16Rik UTSW 13 58382570 missense probably damaging 1.00
R3954:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R3956:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R4012:2210016F16Rik UTSW 13 58381986 nonsense probably null
R4212:2210016F16Rik UTSW 13 58381991 missense probably damaging 1.00
R4712:2210016F16Rik UTSW 13 58381803 missense probably benign 0.06
R5401:2210016F16Rik UTSW 13 58382591 missense probably benign
R6876:2210016F16Rik UTSW 13 58385096 missense probably damaging 1.00
R6957:2210016F16Rik UTSW 13 58381961 missense probably damaging 1.00
R7285:2210016F16Rik UTSW 13 58384385 missense probably damaging 1.00
R7599:2210016F16Rik UTSW 13 58381835 missense probably damaging 0.99
R8553:2210016F16Rik UTSW 13 58384880 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTCGAATAAACCTGCACTAG -3'
(R):5'- CGCCTTTTACAAACGAGCAC -3'

Sequencing Primer
(F):5'- TAGTCCAAGCTGCTCTCGAAC -3'
(R):5'- AGCACAGATCCTCGTGGC -3'
Posted On2015-07-21