Incidental Mutation 'R4469:Rabggta'
ID329337
Institutional Source Beutler Lab
Gene Symbol Rabggta
Ensembl Gene ENSMUSG00000040472
Gene NameRab geranylgeranyl transferase, a subunit
Synonyms
MMRRC Submission 041726-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4469 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55715416-55722263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55716487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000061498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000168729] [ENSMUST00000169237] [ENSMUST00000178034] [ENSMUST00000226907] [ENSMUST00000227061] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect probably benign
Transcript: ENSMUST00000002389
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062861
AA Change: V266A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472
AA Change: V266A

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
AA Change: V536A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472
AA Change: V536A

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168729
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169237
AA Change: V536A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472
AA Change: V536A

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178034
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226209
Predicted Effect probably benign
Transcript: ENSMUST00000226907
Predicted Effect probably benign
Transcript: ENSMUST00000227061
AA Change: V536A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227617
Predicted Effect probably benign
Transcript: ENSMUST00000227958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Predicted Effect probably benign
Transcript: ENSMUST00000228123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228899
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Homozygotes exhibit diluted pigmentation, a platelet defect resulting in prolonged bleeding, macrothrombocytopenia, impaired killing by cytotoxic T lymphocytes, high mortality, and poor breeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,382,425 L257P probably damaging Het
4833420G17Rik A G 13: 119,469,809 K196E probably damaging Het
Ackr1 T C 1: 173,332,545 probably null Het
Adgra1 C T 7: 139,876,061 T535I probably damaging Het
Ankrd11 A G 8: 122,896,587 Y310H probably damaging Het
Arhgef5 T C 6: 43,275,099 I928T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asb4 C A 6: 5,423,409 F185L probably benign Het
Ces2g A T 8: 104,965,970 I301F probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Cntnap4 A T 8: 112,665,266 N121I probably damaging Het
Csf1 C T 3: 107,750,681 probably null Het
Dnah7a T A 1: 53,444,526 H3364L probably benign Het
Dnmt3c A G 2: 153,720,360 T555A possibly damaging Het
Dst A G 1: 34,191,842 T3017A probably benign Het
Efcab7 A G 4: 99,909,704 D482G possibly damaging Het
Fbxl5 A G 5: 43,768,186 V154A probably damaging Het
Flt3 T C 5: 147,375,644 silent Het
G6pd2 A T 5: 61,808,945 Y21F probably benign Het
Gm9376 C T 14: 118,267,599 P148S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
Hcrtr2 T A 9: 76,230,556 T426S probably benign Het
Herc3 T A 6: 58,876,809 Y613* probably null Het
Hsd17b1 A T 11: 101,080,012 M265L probably benign Het
Ier3ip1 A G 18: 76,940,598 probably benign Het
Kif11 A G 19: 37,416,492 M924V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mfsd4b1 T C 10: 40,012,095 probably benign Het
Nlrc5 A T 8: 94,520,839 I1588F probably damaging Het
Nostrin C G 2: 69,175,717 I248M probably damaging Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr125 T C 17: 37,835,716 L239P probably benign Het
Ror2 G A 13: 53,131,980 T66M possibly damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Smad9 T C 3: 54,782,761 V134A probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Ssbp2 G A 13: 91,694,056 G302D probably damaging Het
Stom T C 2: 35,321,533 N159D possibly damaging Het
Trav16d-dv11 A G 14: 53,047,578 K37R probably benign Het
Trim75 A G 8: 64,983,717 V27A probably damaging Het
Ttn T C 2: 76,717,761 T32066A probably damaging Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Ubp1 C T 9: 113,958,707 T222I probably benign Het
Unc5cl C G 17: 48,459,805 P69R possibly damaging Het
Zfp616 T A 11: 74,071,124 C24S probably damaging Het
Other mutations in Rabggta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Rabggta APN 14 55718671 missense probably damaging 0.98
IGL02263:Rabggta APN 14 55718961 splice site probably benign
IGL02293:Rabggta APN 14 55721696 missense probably benign 0.27
IGL02377:Rabggta APN 14 55718495 missense possibly damaging 0.66
IGL02901:Rabggta APN 14 55721681 missense probably benign 0.41
IGL03004:Rabggta APN 14 55719230 splice site probably benign
R0334:Rabggta UTSW 14 55720811 missense probably damaging 1.00
R1914:Rabggta UTSW 14 55721189 missense possibly damaging 0.73
R2926:Rabggta UTSW 14 55719290 missense probably benign 0.00
R5584:Rabggta UTSW 14 55720832 missense probably benign
R6721:Rabggta UTSW 14 55717203 missense probably damaging 1.00
R6960:Rabggta UTSW 14 55721842 critical splice donor site probably null
R7169:Rabggta UTSW 14 55720901 missense probably damaging 0.99
R7447:Rabggta UTSW 14 55719316 missense probably null 0.11
R7805:Rabggta UTSW 14 55719512 missense probably benign 0.00
R8038:Rabggta UTSW 14 55718930 missense probably benign 0.07
R8422:Rabggta UTSW 14 55718458 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTCCAAAATGCACAGTGGTGG -3'
(R):5'- GGCATTCTACAGTCTGTAAGAAACC -3'

Sequencing Primer
(F):5'- CAGCAGTAATGGTAGCTTGGC -3'
(R):5'- GTCTGTAAGAAACCATCAGACTTGC -3'
Posted On2015-07-21