Mutagenetix > Incidental Mutations

Incidental Mutation 'R4470:Dnah7c'

329350

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

041727-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R4470 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46748635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 3283 (S3283T)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189749
AA Change: S3283T

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: S3283T

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Meta Mutation Damage Score

0.1171

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	C	16: 85,798,516	V258G	possibly damaging	Het
Adcy1	A	G	11: 7,144,804	T577A	probably benign	Het
Adgb	T	C	10: 10,398,951	N728S	probably benign	Het
Alpk1	A	G	3: 127,679,526	S943P	probably damaging	Het
Ankdd1a	T	C	9: 65,503,509	D398G	probably damaging	Het
Asah1	A	G	8: 41,343,724		probably null	Het
Atp13a1	T	C	8: 69,798,679	S495P	probably damaging	Het
Camta2	T	C	11: 70,680,940	D510G	probably damaging	Het
Cdh8	T	A	8: 99,416,689		probably benign	Het
Cul9	C	T	17: 46,538,336	A628T	probably benign	Het
Ddx19a	A	G	8: 110,976,479	V442A	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Fmo9	T	A	1: 166,680,230	I19F	probably damaging	Het
Gmeb2	A	T	2: 181,265,145		probably null	Het
H2-K1	G	A	17: 34,000,061	R23C	probably benign	Het
Icam5	T	A	9: 21,035,506	C443*	probably null	Het
Il16	A	G	7: 83,650,838		probably benign	Het
Kcnj3	A	T	2: 55,437,865	H222L	probably damaging	Het
Lama4	T	A	10: 39,080,496	Y1138*	probably null	Het
Lpin3	A	G	2: 160,895,434	T134A	probably benign	Het
Man1b1	C	G	2: 25,332,855		probably benign	Het
Msc	G	C	1: 14,755,678	P24R	probably damaging	Het
Mylk	A	G	16: 34,912,152	K601E	probably benign	Het
Myzap	A	G	9: 71,592,281		probably benign	Het
Ncor2	A	T	5: 125,102,641		probably null	Het
Nrxn3	T	C	12: 90,204,741	S276P	probably damaging	Het
Olfr1219	T	C	2: 89,075,038	N18D	probably benign	Het
Olfr1428	T	C	19: 12,109,183		probably null	Het
Olfr26	T	C	9: 38,855,631	S190P	probably damaging	Het
Olfr345	T	C	2: 36,640,221	F61L	probably damaging	Het
Olfr66	G	A	7: 103,881,749	P165S	probably benign	Het
Olfr771	G	A	10: 129,160,514	L157F	probably benign	Het
Olfr891	A	G	9: 38,180,370	M151T	probably damaging	Het
Pramel5	T	C	4: 144,271,345	K443E	possibly damaging	Het
Rock2	C	T	12: 16,971,275	Q1019*	probably null	Het
Rps18-ps3	T	A	8: 107,263,130		noncoding transcript	Het
Sis	T	C	3: 72,928,159		probably null	Het
Slc22a21	T	A	11: 53,956,013	I345F	probably benign	Het
Sox5	A	G	6: 143,844,765	M523T	possibly damaging	Het
Taf1c	T	C	8: 119,599,622	K526R	probably benign	Het
Taf2	T	C	15: 55,058,880	D337G	possibly damaging	Het
Tbx4	A	G	11: 85,912,122	I275V	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmem9	A	G	1: 136,027,496	T123A	probably benign	Het
Trim69	A	G	2: 122,178,599	Y380C	probably damaging	Het
Vldlr	G	T	19: 27,234,819	V78L	probably damaging	Het
Vmn1r68	A	T	7: 10,527,348	N274K	probably benign	Het
Vmn2r104	G	T	17: 20,042,241	S209Y	probably damaging	Het
Vmn2r108	T	A	17: 20,462,728	N738I	probably damaging	Het
Wnt3	A	G	11: 103,812,624	D311G	probably damaging	Het
Yme1l1	T	C	2: 23,186,332		probably null	Het
Zcchc14	C	T	8: 121,651,759		probably benign	Het
Zfp148	T	C	16: 33,496,232	Y383H	probably damaging	Het
Zfp41	A	G	15: 75,618,519	R107G	probably damaging	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TAGCAGTCTGTGGGGCAATC -3'
(R):5'- TCTTCCGCAAAGACTAGAAAATGAC -3'

Sequencing Primer
(F):5'- GTGGGGCAATCTTAGCATTCCC -3'
(R):5'- TCTACAGGTAATACAACTGGGCCTAG -3'

Posted On

2015-07-21