Incidental Mutation 'R4470:Trim69'
ID329358
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122178599 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 380 (Y380C)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036089
AA Change: Y380C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: Y380C

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143088
Meta Mutation Damage Score 0.8493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
Z1176:Trim69 UTSW 2 122167554 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTTTCGTACCAGGCCCATC -3'
(R):5'- GCCCTCATAATCCAGGTACACG -3'

Sequencing Primer
(F):5'- AGGCCCATCTCAATTAACTCTGG -3'
(R):5'- TGAGGTCGCCTAGAGTCAGACTAC -3'
Posted On2015-07-21