Incidental Mutation 'R4470:Gmeb2'
ID329360
Institutional Source Beutler Lab
Gene Symbol Gmeb2
Ensembl Gene ENSMUSG00000038705
Gene Nameglucocorticoid modulatory element binding protein 2
Synonyms
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181251449-181288035 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 181265145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049032] [ENSMUST00000130475] [ENSMUST00000130475] [ENSMUST00000141003] [ENSMUST00000141110]
Predicted Effect probably null
Transcript: ENSMUST00000049032
SMART Domains Protein: ENSMUSP00000037075
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
coiled coil region 304 347 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 475 488 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130475
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130475
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141003
SMART Domains Protein: ENSMUSP00000116854
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SAND 81 126 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141110
SMART Domains Protein: ENSMUSP00000115853
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147665
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Gmeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Gmeb2 APN 2 181259043 missense probably benign 0.18
IGL02882:Gmeb2 APN 2 181265883 missense probably damaging 0.98
R0437:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R1499:Gmeb2 UTSW 2 181255226 missense probably benign 0.01
R2064:Gmeb2 UTSW 2 181253970 missense probably benign 0.42
R2127:Gmeb2 UTSW 2 181259049 missense probably benign 0.21
R2517:Gmeb2 UTSW 2 181259026 missense probably benign 0.12
R3087:Gmeb2 UTSW 2 181255640 splice site probably benign
R4202:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R4936:Gmeb2 UTSW 2 181254246 missense probably benign 0.04
R5296:Gmeb2 UTSW 2 181255986 intron probably benign
R5402:Gmeb2 UTSW 2 181255957 splice site probably null
R5708:Gmeb2 UTSW 2 181264989 missense probably damaging 1.00
R5934:Gmeb2 UTSW 2 181255574 missense possibly damaging 0.63
R7673:Gmeb2 UTSW 2 181260388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGTAGGCAGATGCTAC -3'
(R):5'- AACATGGTTCTTCAGTTGGGC -3'

Sequencing Primer
(F):5'- TAAAGGTGTGCGCCTCAC -3'
(R):5'- CAGTTGGGCATTGTTTAATGAGC -3'
Posted On2015-07-21