Incidental Mutation 'R4470:Atp13a1'
ID329370
Institutional Source Beutler Lab
Gene Symbol Atp13a1
Ensembl Gene ENSMUSG00000031862
Gene NameATPase type 13A1
SynonymsCgi152, Atp13a, catp
MMRRC Submission 041727-MU
Accession Numbers

Ncbi RefSeq: NM_133224.2; MGI: 2180801

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69791163-69807749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69798679 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 495 (S495P)
Ref Sequence ENSEMBL: ENSMUSP00000034326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326]
Predicted Effect probably damaging
Transcript: ENSMUST00000034326
AA Change: S495P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862
AA Change: S495P

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Meta Mutation Damage Score 0.9538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Atp13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Atp13a1 APN 8 69796897 missense probably damaging 1.00
IGL00949:Atp13a1 APN 8 69800003 splice site probably benign
IGL01122:Atp13a1 APN 8 69798905 missense probably damaging 1.00
IGL02399:Atp13a1 APN 8 69807101 missense probably damaging 1.00
IGL02616:Atp13a1 APN 8 69805313 missense probably benign
IGL03073:Atp13a1 APN 8 69798502 missense probably damaging 1.00
yun_nan UTSW 8 69798679 missense probably damaging 1.00
P0005:Atp13a1 UTSW 8 69803747 missense possibly damaging 0.88
R0086:Atp13a1 UTSW 8 69797774 missense possibly damaging 0.86
R0384:Atp13a1 UTSW 8 69797324 missense possibly damaging 0.89
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0974:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R2010:Atp13a1 UTSW 8 69791360 missense possibly damaging 0.77
R2040:Atp13a1 UTSW 8 69807052 missense possibly damaging 0.76
R2069:Atp13a1 UTSW 8 69799773 missense probably benign 0.00
R4274:Atp13a1 UTSW 8 69805292 missense probably benign
R4288:Atp13a1 UTSW 8 69794078 missense possibly damaging 0.89
R5408:Atp13a1 UTSW 8 69796840 missense probably benign 0.41
R5916:Atp13a1 UTSW 8 69807098 missense probably damaging 1.00
R5920:Atp13a1 UTSW 8 69800096 missense probably benign 0.02
R5951:Atp13a1 UTSW 8 69797285 missense probably damaging 1.00
R6143:Atp13a1 UTSW 8 69805360 missense probably benign
R6467:Atp13a1 UTSW 8 69806774 missense probably damaging 1.00
R6487:Atp13a1 UTSW 8 69799878 missense probably damaging 0.99
R7166:Atp13a1 UTSW 8 69799316 splice site probably null
R7652:Atp13a1 UTSW 8 69805559 missense probably damaging 0.97
R8014:Atp13a1 UTSW 8 69799779 nonsense probably null
RF001:Atp13a1 UTSW 8 69800070 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTGCTGCAGCTGCGTATG -3'
(R):5'- ACCCGTCTTGTCAAAGCAAC -3'

Sequencing Primer
(F):5'- CTGCAGCTGCGTATGTGTGG -3'
(R):5'- TTCAACCTTGCCAGCGAAGG -3'
Posted On2015-07-21