Incidental Mutation 'R4470:Ddx19a'
ID329373
Institutional Source Beutler Lab
Gene Symbol Ddx19a
Ensembl Gene ENSMUSG00000015023
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
SynonymsEif4a-rs1, Ddx19, DBP5
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110974996-110997800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110976479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 442 (V442A)
Ref Sequence ENSEMBL: ENSMUSP00000047898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034197] [ENSMUST00000040416]
Predicted Effect probably benign
Transcript: ENSMUST00000034197
SMART Domains Protein: ENSMUSP00000034197
Gene: ENSMUSG00000031749

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 94 349 3.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040416
AA Change: V442A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047898
Gene: ENSMUSG00000015023
AA Change: V442A

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
DEXDc 110 309 8.58e-44 SMART
HELICc 346 433 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173183
Meta Mutation Damage Score 0.3637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Ddx19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ddx19a APN 8 110976470 missense probably benign
IGL01395:Ddx19a APN 8 110990532 splice site probably benign
IGL01676:Ddx19a APN 8 110980989 critical splice donor site probably null
IGL02243:Ddx19a APN 8 110976456 missense probably benign 0.06
IGL02677:Ddx19a APN 8 110989609 missense probably benign 0.24
IGL02870:Ddx19a APN 8 110983626 missense probably damaging 1.00
R0416:Ddx19a UTSW 8 110979057 missense probably damaging 0.96
R1574:Ddx19a UTSW 8 110993111 splice site probably benign
R1664:Ddx19a UTSW 8 110989498 missense probably damaging 0.99
R4552:Ddx19a UTSW 8 110978566 nonsense probably null
R4668:Ddx19a UTSW 8 110979084 missense probably damaging 1.00
R4847:Ddx19a UTSW 8 110977045 missense probably damaging 1.00
R5390:Ddx19a UTSW 8 110980631 nonsense probably null
R5815:Ddx19a UTSW 8 110979149 nonsense probably null
R6842:Ddx19a UTSW 8 110978625 missense possibly damaging 0.69
R7045:Ddx19a UTSW 8 110993074 missense probably benign
R7647:Ddx19a UTSW 8 110976627 splice site probably null
R8186:Ddx19a UTSW 8 110983642 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCCCAGGAAGTCAGGTTC -3'
(R):5'- TGTCCCAGGCATGTCTTCAG -3'

Sequencing Primer
(F):5'- AGGAAGTCAGGTTCTCCCAG -3'
(R):5'- GGCATGTCTTCAGCCCAAC -3'
Posted On2015-07-21