Incidental Mutation 'R4470:Icam5'
ID329375
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21035506 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 443 (C443*)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001040] [ENSMUST00000019616] [ENSMUST00000215077]
Predicted Effect probably benign
Transcript: ENSMUST00000001040
SMART Domains Protein: ENSMUSP00000001040
Gene: ENSMUSG00000001014

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ICAM_N 37 128 2.5e-17 PFAM
Blast:IG_like 133 224 1e-9 BLAST
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000019616
AA Change: C443*
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: C443*

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Predicted Effect probably benign
Transcript: ENSMUST00000215077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216917
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0002:Icam5 UTSW 9 21033505 missense probably benign 0.00
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1485:Icam5 UTSW 9 21036406 missense probably benign 0.34
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R3125:Icam5 UTSW 9 21036658 missense probably benign 0.00
R4117:Icam5 UTSW 9 21037590 missense probably damaging 0.99
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R4826:Icam5 UTSW 9 21037803 missense possibly damaging 0.67
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
R7229:Icam5 UTSW 9 21037001 missense possibly damaging 0.79
R7395:Icam5 UTSW 9 21035442 missense possibly damaging 0.77
R7414:Icam5 UTSW 9 21037593 missense probably damaging 0.98
R7423:Icam5 UTSW 9 21036905 missense probably benign
R8032:Icam5 UTSW 9 21033218 missense probably benign 0.35
Z1177:Icam5 UTSW 9 21035548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTCTGTGACCTCCAAAGCC -3'
(R):5'- TCCCTGCAGAATCCAGCTTC -3'

Sequencing Primer
(F):5'- TGTGACCTCCAAAGCCCCTATTAC -3'
(R):5'- CCCCTAACTCGGTGAACTTGG -3'
Posted On2015-07-21