Incidental Mutation 'R4470:Olfr26'
ID329377
Institutional Source Beutler Lab
Gene Symbol Olfr26
Ensembl Gene ENSMUSG00000047667
Gene Nameolfactory receptor 26
SynonymsMTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38855060-38855990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38855631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: S190P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: S190P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.3021 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Olfr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Olfr26 APN 9 38855799 missense probably benign 0.00
IGL01909:Olfr26 APN 9 38855717 nonsense probably null
IGL02146:Olfr26 APN 9 38855358 missense probably benign 0.01
IGL02229:Olfr26 APN 9 38855416 missense possibly damaging 0.62
IGL02382:Olfr26 APN 9 38855068 missense probably benign
IGL03007:Olfr26 APN 9 38855296 missense probably damaging 1.00
IGL03118:Olfr26 APN 9 38855230 missense probably damaging 1.00
PIT4403001:Olfr26 UTSW 9 38855380 missense probably benign 0.39
R0590:Olfr26 UTSW 9 38855470 missense probably damaging 0.99
R0862:Olfr26 UTSW 9 38855182 missense possibly damaging 0.89
R1779:Olfr26 UTSW 9 38855550 missense possibly damaging 0.55
R1796:Olfr26 UTSW 9 38855524 missense probably benign 0.01
R2083:Olfr26 UTSW 9 38855341 missense probably benign 0.10
R3420:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R3421:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R4328:Olfr26 UTSW 9 38855836 missense possibly damaging 0.62
R4471:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R5047:Olfr26 UTSW 9 38855289 missense probably benign 0.36
R5267:Olfr26 UTSW 9 38855805 missense probably damaging 1.00
R5318:Olfr26 UTSW 9 38855448 missense probably damaging 1.00
R6502:Olfr26 UTSW 9 38855637 missense probably damaging 0.99
R7221:Olfr26 UTSW 9 38855242 missense probably damaging 1.00
R7297:Olfr26 UTSW 9 38855949 missense probably damaging 1.00
R7448:Olfr26 UTSW 9 38855116 missense probably damaging 1.00
R7525:Olfr26 UTSW 9 38855238 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GACTGCCATGGCGTATGATC -3'
(R):5'- CACAGCCATAAGATGAGAGCTG -3'

Sequencing Primer
(F):5'- ATCGCTATGTGGCCATCTGTAGAC -3'
(R):5'- AGCTGCAGGTTCCAAAGGATTTG -3'
Posted On2015-07-21