Incidental Mutation 'R4470:Myzap'
ID329379
Institutional Source Beutler Lab
Gene Symbol Myzap
Ensembl Gene ENSMUSG00000041361
Gene Namemyocardial zonula adherens protein
SynonymsMyozap, Grinl1a7, Gcom1
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4470 (G1)
Quality Score176
Status Validated
Chromosome9
Chromosomal Location71504347-71592360 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 71592281 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093823] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166112] [ENSMUST00000166843] [ENSMUST00000169573]
Predicted Effect probably benign
Transcript: ENSMUST00000093823
SMART Domains Protein: ENSMUSP00000091342
Gene: ENSMUSG00000041361

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163708
Predicted Effect probably benign
Transcript: ENSMUST00000163998
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166112
Predicted Effect probably benign
Transcript: ENSMUST00000166843
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169573
SMART Domains Protein: ENSMUSP00000127028
Gene: ENSMUSG00000041361

DomainStartEndE-ValueType
Pfam:GCOM2 96 388 6.6e-68 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is abundantly expressed in cardiac tissue. The encoded protein localizes to intercalated discs in cardiomyocytes and functions as an activator of Rho-dependent serum-response factor signaling. Alternative splicing results in multiple transcript variants. Readthrough transcription also exists between this gene and the neighboring downstream gene POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) and is represented with GeneID: 145781. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous KO results in a maladaptive response to increased biomechanical stress, resulting in adverse cardiac remodeling, contractile dysfunction, heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Myzap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Myzap APN 9 71555671 missense probably benign 0.06
IGL01077:Myzap APN 9 71546760 missense probably damaging 1.00
IGL01478:Myzap APN 9 71515067 critical splice donor site probably null
IGL02146:Myzap APN 9 71564448 missense probably benign 0.43
IGL02715:Myzap APN 9 71515115 nonsense probably null
IGL03218:Myzap APN 9 71555589 missense probably benign 0.40
R0674:Myzap UTSW 9 71515144 missense probably damaging 1.00
R2298:Myzap UTSW 9 71548757 missense probably damaging 0.98
R4463:Myzap UTSW 9 71555651 missense probably benign 0.00
R4548:Myzap UTSW 9 71550246 missense possibly damaging 0.67
R4841:Myzap UTSW 9 71548755 missense probably damaging 1.00
R4842:Myzap UTSW 9 71548755 missense probably damaging 1.00
R6284:Myzap UTSW 9 71558925 missense probably benign 0.21
R6307:Myzap UTSW 9 71558864 missense possibly damaging 0.92
R7427:Myzap UTSW 9 71505183 missense probably benign 0.00
R7489:Myzap UTSW 9 71561038 missense probably benign 0.09
X0018:Myzap UTSW 9 71550295 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCCAGGAAACTTGAGCCAAG -3'
(R):5'- ATGCTGCTTGACTAGTCTGGC -3'

Sequencing Primer
(F):5'- CTTGAGCCAAGACTGAGGTATC -3'
(R):5'- TGACTAGTCTGGCAGAATCCTAGC -3'
Posted On2015-07-21