Incidental Mutation 'R4470:Adcy1'
ID329383
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7144804 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 577 (T577A)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably benign
Transcript: ENSMUST00000020706
AA Change: T577A

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: T577A

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tbx4 A G 11: 85,912,122 I275V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
PIT4431001:Adcy1 UTSW 11 7064089 missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7167133 missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R0569:Adcy1 UTSW 11 7146514 missense probably benign 0.34
R1055:Adcy1 UTSW 11 7109075 missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1245:Adcy1 UTSW 11 7169410 splice site probably benign
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5341:Adcy1 UTSW 11 7130375 missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7079026 missense probably damaging 1.00
R7368:Adcy1 UTSW 11 7144765 missense probably damaging 1.00
R7378:Adcy1 UTSW 11 7169543 missense possibly damaging 0.56
R7393:Adcy1 UTSW 11 7137381 missense probably damaging 1.00
R7500:Adcy1 UTSW 11 7144762 missense probably damaging 1.00
R7529:Adcy1 UTSW 11 7139157 missense probably damaging 0.98
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Z1176:Adcy1 UTSW 11 7109098 missense probably damaging 1.00
Z1176:Adcy1 UTSW 11 7149536 missense probably damaging 0.99
Z1176:Adcy1 UTSW 11 7150857 missense probably damaging 0.96
Z1176:Adcy1 UTSW 11 7150858 missense possibly damaging 0.62
Z1177:Adcy1 UTSW 11 7100642 nonsense probably null
Z1177:Adcy1 UTSW 11 7144802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCCATGAGTGCTTTTG -3'
(R):5'- TCCTGAAGCTGGTGGTACTG -3'

Sequencing Primer
(F):5'- CCCATGAGTGCTTTTGTTTGAAAC -3'
(R):5'- AAGCTGGTGGTACTGTGAAG -3'
Posted On2015-07-21