Mutagenetix > Incidental Mutation

Incidental Mutation 'R0047:Cux1'

32940

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

038341-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.838) question?

Stock #

R0047 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 136363253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000177297] [ENSMUST00000176778]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004097

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148082

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175975

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176172

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176423

SMART Domains

Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176486

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176501

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176778

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,264	T405A	probably damaging	Het
4932438A13Rik	T	A	3: 36,908,192	L481M	possibly damaging	Het
Acer1	A	T	17: 56,955,624	D175E	possibly damaging	Het
Acsf2	T	C	11: 94,569,342	I395V	probably benign	Het
Adamts9	G	A	6: 92,905,306		probably benign	Het
Amigo3	T	C	9: 108,054,658	S427P	probably benign	Het
Ankrd35	A	G	3: 96,684,063	K555R	probably benign	Het
Arhgap35	A	T	7: 16,561,992	H1049Q	probably benign	Het
Arhgef5	G	A	6: 43,265,621		probably null	Het
Arid4a	T	G	12: 71,075,419	L858W	probably damaging	Het
Bbox1	A	G	2: 110,268,302	F310S	probably damaging	Het
Bhlhe22	T	C	3: 18,055,569	L261P	probably damaging	Het
Bmper	T	A	9: 23,406,686	C534S	probably damaging	Het
Cacna1d	T	G	14: 30,346,790		probably benign	Het
Camk2g	G	A	14: 20,771,068		probably benign	Het
Capn12	G	A	7: 28,890,387		probably null	Het
Cdkl4	T	G	17: 80,550,845	N115T	probably benign	Het
Chchd1	T	C	14: 20,704,163	S48P	possibly damaging	Het
Chia1	G	T	3: 106,115,257	C49F	probably damaging	Het
Cnot7	A	G	8: 40,495,921		probably benign	Het
Crh	T	C	3: 19,694,037	E147G	probably damaging	Het
Cyp2b19	T	A	7: 26,766,826	D351E	probably benign	Het
Dctn1	G	T	6: 83,182,632	G31*	probably null	Het
Duox1	T	A	2: 122,346,641		probably benign	Het
Egflam	T	G	15: 7,253,430	E382A	possibly damaging	Het
Ext1	T	C	15: 53,345,146	N73S	probably benign	Het
Ffar4	A	G	19: 38,114,004		probably benign	Het
Glg1	A	T	8: 111,165,582	M866K	probably damaging	Het
Golm1	T	A	13: 59,645,100	H197L	probably benign	Het
Gtse1	A	G	15: 85,862,378	K132E	probably damaging	Het
Gxylt2	A	T	6: 100,733,378		probably benign	Het
Hrc	T	A	7: 45,336,689	S421R	probably benign	Het
Ighg2c	T	A	12: 113,288,168		probably benign	Het
Ihh	A	G	1: 74,946,591	I245T	probably benign	Het
Ilf3	T	A	9: 21,388,714	M65K	possibly damaging	Het
Insr	A	G	8: 3,202,947	V404A	probably damaging	Het
Irak2	G	T	6: 113,672,953		probably benign	Het
Irak2	G	A	6: 113,678,738	V367I	probably benign	Het
Kat7	A	C	11: 95,300,208	N119K	probably benign	Het
Kif9	A	G	9: 110,485,038	I33V	probably benign	Het
Klf17	A	G	4: 117,761,032	Y43H	probably benign	Het
Kng2	T	A	16: 22,987,563	T629S	possibly damaging	Het
Lama1	A	T	17: 67,795,186		probably benign	Het
Lamb1	T	C	12: 31,278,601	I188T	possibly damaging	Het
Lpp	T	A	16: 24,661,800		probably benign	Het
Lrp12	T	C	15: 39,878,239	E360G	probably damaging	Het
Mark2	A	C	19: 7,283,577		probably benign	Het
Mmp3	T	C	9: 7,451,910		probably benign	Het
Mthfd1l	T	A	10: 3,978,727		probably benign	Het
Mtr	A	T	13: 12,222,226	S569T	probably damaging	Het
Myh13	T	A	11: 67,367,237	S1752T	probably benign	Het
Myo5a	T	A	9: 75,156,207	L565H	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nfkb1	A	T	3: 135,595,053	L72*	probably null	Het
Numa1	A	G	7: 102,009,453	K296E	probably damaging	Het
Olfr1477	A	G	19: 13,502,589	E82G	probably benign	Het
Olfr186	T	A	16: 59,027,224	M228L	probably benign	Het
Olfr201	C	T	16: 59,269,211	G152D	probably damaging	Het
Olfr508	A	G	7: 108,630,552	I187V	probably benign	Het
Olfr613	A	T	7: 103,552,322	Y179F	probably damaging	Het
Pcdhb5	A	T	18: 37,321,268	I234F	possibly damaging	Het
Pgm5	T	A	19: 24,684,556	I545F	probably damaging	Het
Pla2g2c	T	C	4: 138,743,590		probably benign	Het
Pnpla7	A	T	2: 25,011,606	E548V	probably damaging	Het
Ppm1m	C	A	9: 106,196,696	E273*	probably null	Het
Ppp2r1b	C	T	9: 50,861,573	R117*	probably null	Het
Rabgap1l	G	A	1: 160,231,789		probably benign	Het
Rapgef6	T	A	11: 54,546,378	M49K	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rnf219	T	A	14: 104,503,344		probably null	Het
Rtel1	T	G	2: 181,323,405	I146M	probably damaging	Het
Sdr9c7	A	T	10: 127,903,672	M219L	probably benign	Het
Serpina3g	T	A	12: 104,240,284	S115T	possibly damaging	Het
Serpinb1a	A	T	13: 32,850,276	L44Q	probably damaging	Het
Slc13a4	A	G	6: 35,287,362	I190T	possibly damaging	Het
Slc46a2	A	G	4: 59,914,392	L177P	probably damaging	Het
Slc47a2	C	T	11: 61,336,242	V167M	possibly damaging	Het
Snrnp200	C	T	2: 127,234,954		probably benign	Het
Snx13	C	A	12: 35,101,124		probably benign	Het
Snx25	C	T	8: 46,041,365	A828T	probably damaging	Het
Spic	A	G	10: 88,675,941	L151P	probably damaging	Het
Ssu2	G	A	6: 112,374,820	H315Y	probably damaging	Het
Stk32a	T	C	18: 43,313,378		probably benign	Het
Tbx3	A	T	5: 119,680,446	E382V	probably damaging	Het
Tcaf2	A	G	6: 42,629,613	I469T	probably benign	Het
Tln2	A	G	9: 67,240,672		probably benign	Het
Top2a	T	A	11: 98,997,856	I1260L	probably benign	Het
Treml1	C	A	17: 48,364,980	S91*	probably null	Het
Trim26	T	C	17: 36,857,864		probably benign	Het
Trmt11	T	C	10: 30,535,243	N418S	probably benign	Het
Ttf1	A	G	2: 29,084,655	Y801C	probably damaging	Het
Usp34	C	T	11: 23,464,403	A2782V	probably benign	Het
Vmn2r77	T	C	7: 86,811,650	V728A	probably benign	Het
Vps4a	T	C	8: 107,036,701	L29P	probably damaging	Het
Wdfy3	A	G	5: 101,944,033	I480T	probably damaging	Het
Wdr41	A	G	13: 95,010,287	I197V	probably damaging	Het
Ywhag	A	T	5: 135,911,299	V147E	probably damaging	Het
Zan	A	G	5: 137,403,656	M4058T	unknown	Het
Zfp236	C	T	18: 82,680,692	C88Y	probably damaging	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8671:Cux1	UTSW	5	136250600	missense	probably damaging	1.00
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97
R9712:Cux1	UTSW	5	136309819	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- ACTAATGCAGCCAGGTAGAGCAGC -3'
(R):5'- TCACAACATTGAGGTGCAGAGAGTC -3'

Sequencing Primer
(F):5'- AGCCTGGGACACAAGCTTC -3'
(R):5'- GCAAGAGACACAGATGTCCA -3'

Posted On

2013-05-09