Incidental Mutation 'R0047:Cux1'
ID 32940
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission 038341-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R0047 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 136392107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000177297] [ENSMUST00000176778]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004097
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176172
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176501
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176423
SMART Domains Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176486
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176778
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,772,025 (GRCm39) T405A probably damaging Het
Acer1 A T 17: 57,262,624 (GRCm39) D175E possibly damaging Het
Acsf2 T C 11: 94,460,168 (GRCm39) I395V probably benign Het
Adamts9 G A 6: 92,882,287 (GRCm39) probably benign Het
Amigo3 T C 9: 107,931,857 (GRCm39) S427P probably benign Het
Ankrd35 A G 3: 96,591,379 (GRCm39) K555R probably benign Het
Arhgap35 A T 7: 16,295,917 (GRCm39) H1049Q probably benign Het
Arhgef5 G A 6: 43,242,555 (GRCm39) probably null Het
Arid4a T G 12: 71,122,193 (GRCm39) L858W probably damaging Het
Bbox1 A G 2: 110,098,647 (GRCm39) F310S probably damaging Het
Bhlhe22 T C 3: 18,109,733 (GRCm39) L261P probably damaging Het
Bltp1 T A 3: 36,962,341 (GRCm39) L481M possibly damaging Het
Bmper T A 9: 23,317,982 (GRCm39) C534S probably damaging Het
Cacna1d T G 14: 30,068,747 (GRCm39) probably benign Het
Camk2g G A 14: 20,821,136 (GRCm39) probably benign Het
Capn12 G A 7: 28,589,812 (GRCm39) probably null Het
Cdkl4 T G 17: 80,858,274 (GRCm39) N115T probably benign Het
Chchd1 T C 14: 20,754,231 (GRCm39) S48P possibly damaging Het
Chia1 G T 3: 106,022,573 (GRCm39) C49F probably damaging Het
Cnot7 A G 8: 40,948,962 (GRCm39) probably benign Het
Crh T C 3: 19,748,201 (GRCm39) E147G probably damaging Het
Cyp2b19 T A 7: 26,466,251 (GRCm39) D351E probably benign Het
Dctn1 G T 6: 83,159,614 (GRCm39) G31* probably null Het
Duox1 T A 2: 122,177,122 (GRCm39) probably benign Het
Egflam T G 15: 7,282,911 (GRCm39) E382A possibly damaging Het
Ext1 T C 15: 53,208,542 (GRCm39) N73S probably benign Het
Ffar4 A G 19: 38,102,452 (GRCm39) probably benign Het
Glg1 A T 8: 111,892,214 (GRCm39) M866K probably damaging Het
Golm1 T A 13: 59,792,914 (GRCm39) H197L probably benign Het
Gtse1 A G 15: 85,746,579 (GRCm39) K132E probably damaging Het
Gxylt2 A T 6: 100,710,339 (GRCm39) probably benign Het
Hrc T A 7: 44,986,113 (GRCm39) S421R probably benign Het
Ighg2c T A 12: 113,251,788 (GRCm39) probably benign Het
Ihh A G 1: 74,985,750 (GRCm39) I245T probably benign Het
Ilf3 T A 9: 21,300,010 (GRCm39) M65K possibly damaging Het
Insr A G 8: 3,252,947 (GRCm39) V404A probably damaging Het
Irak2 G T 6: 113,649,914 (GRCm39) probably benign Het
Irak2 G A 6: 113,655,699 (GRCm39) V367I probably benign Het
Kat7 A C 11: 95,191,034 (GRCm39) N119K probably benign Het
Kif9 A G 9: 110,314,106 (GRCm39) I33V probably benign Het
Klf17 A G 4: 117,618,229 (GRCm39) Y43H probably benign Het
Kng2 T A 16: 22,806,313 (GRCm39) T629S possibly damaging Het
Lama1 A T 17: 68,102,181 (GRCm39) probably benign Het
Lamb1 T C 12: 31,328,600 (GRCm39) I188T possibly damaging Het
Lpp T A 16: 24,480,550 (GRCm39) probably benign Het
Lrp12 T C 15: 39,741,635 (GRCm39) E360G probably damaging Het
Mark2 A C 19: 7,260,942 (GRCm39) probably benign Het
Mmp3 T C 9: 7,451,910 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,928,727 (GRCm39) probably benign Het
Mtr A T 13: 12,237,112 (GRCm39) S569T probably damaging Het
Myh13 T A 11: 67,258,063 (GRCm39) S1752T probably benign Het
Myo5a T A 9: 75,063,489 (GRCm39) L565H probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nfkb1 A T 3: 135,300,814 (GRCm39) L72* probably null Het
Numa1 A G 7: 101,658,660 (GRCm39) K296E probably damaging Het
Obi1 T A 14: 104,740,780 (GRCm39) probably null Het
Or51ab3 A T 7: 103,201,529 (GRCm39) Y179F probably damaging Het
Or5ac19 C T 16: 59,089,574 (GRCm39) G152D probably damaging Het
Or5b120 A G 19: 13,479,953 (GRCm39) E82G probably benign Het
Or5h18 T A 16: 58,847,587 (GRCm39) M228L probably benign Het
Or5p80 A G 7: 108,229,759 (GRCm39) I187V probably benign Het
Pcdhb5 A T 18: 37,454,321 (GRCm39) I234F possibly damaging Het
Pgm5 T A 19: 24,661,920 (GRCm39) I545F probably damaging Het
Pla2g2c T C 4: 138,470,901 (GRCm39) probably benign Het
Pnpla7 A T 2: 24,901,618 (GRCm39) E548V probably damaging Het
Ppm1m C A 9: 106,073,895 (GRCm39) E273* probably null Het
Ppp2r1b C T 9: 50,772,873 (GRCm39) R117* probably null Het
Rabgap1l G A 1: 160,059,359 (GRCm39) probably benign Het
Rapgef6 T A 11: 54,437,204 (GRCm39) M49K possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Rtel1 T G 2: 180,965,198 (GRCm39) I146M probably damaging Het
Sdr9c7 A T 10: 127,739,541 (GRCm39) M219L probably benign Het
Serpina3g T A 12: 104,206,543 (GRCm39) S115T possibly damaging Het
Serpinb1a A T 13: 33,034,259 (GRCm39) L44Q probably damaging Het
Slc13a4 A G 6: 35,264,297 (GRCm39) I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 (GRCm39) L177P probably damaging Het
Slc47a2 C T 11: 61,227,068 (GRCm39) V167M possibly damaging Het
Snrnp200 C T 2: 127,076,874 (GRCm39) probably benign Het
Snx13 C A 12: 35,151,123 (GRCm39) probably benign Het
Snx25 C T 8: 46,494,402 (GRCm39) A828T probably damaging Het
Spic A G 10: 88,511,803 (GRCm39) L151P probably damaging Het
Ssu2 G A 6: 112,351,781 (GRCm39) H315Y probably damaging Het
Stk32a T C 18: 43,446,443 (GRCm39) probably benign Het
Tbx3 A T 5: 119,818,511 (GRCm39) E382V probably damaging Het
Tcaf2 A G 6: 42,606,547 (GRCm39) I469T probably benign Het
Tln2 A G 9: 67,147,954 (GRCm39) probably benign Het
Top2a T A 11: 98,888,682 (GRCm39) I1260L probably benign Het
Treml1 C A 17: 48,672,008 (GRCm39) S91* probably null Het
Trim26 T C 17: 37,168,756 (GRCm39) probably benign Het
Trmt11 T C 10: 30,411,239 (GRCm39) N418S probably benign Het
Ttf1 A G 2: 28,974,667 (GRCm39) Y801C probably damaging Het
Usp34 C T 11: 23,414,403 (GRCm39) A2782V probably benign Het
Vmn2r77 T C 7: 86,460,858 (GRCm39) V728A probably benign Het
Vps4a T C 8: 107,763,333 (GRCm39) L29P probably damaging Het
Wdfy3 A G 5: 102,091,899 (GRCm39) I480T probably damaging Het
Wdr41 A G 13: 95,146,795 (GRCm39) I197V probably damaging Het
Ywhag A T 5: 135,940,153 (GRCm39) V147E probably damaging Het
Zan A G 5: 137,401,918 (GRCm39) M4058T unknown Het
Zfp236 C T 18: 82,698,817 (GRCm39) C88Y probably damaging Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0533:Cux1 UTSW 5 136,336,713 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2051:Cux1 UTSW 5 136,361,512 (GRCm39) missense probably damaging 1.00
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6531:Cux1 UTSW 5 136,303,973 (GRCm39) missense probably benign 0.03
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8305:Cux1 UTSW 5 136,388,863 (GRCm39) missense probably benign 0.02
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9205:Cux1 UTSW 5 136,398,989 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACTAATGCAGCCAGGTAGAGCAGC -3'
(R):5'- TCACAACATTGAGGTGCAGAGAGTC -3'

Sequencing Primer
(F):5'- AGCCTGGGACACAAGCTTC -3'
(R):5'- GCAAGAGACACAGATGTCCA -3'
Posted On 2013-05-09