Incidental Mutation 'R4471:Ivns1abp'
ID329404
Institutional Source Beutler Lab
Gene Symbol Ivns1abp
Ensembl Gene ENSMUSG00000023150
Gene Nameinfluenza virus NS1A binding protein
SynonymsNS-1, Nd1-L, Nd1-S, 1700126I16Rik, 1190004M08Rik, ND1, HSPC068, NS1-BP
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151344477-151364422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151361239 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 447 (T447M)
Ref Sequence ENSEMBL: ENSMUSP00000095150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023918] [ENSMUST00000097543] [ENSMUST00000111887] [ENSMUST00000186745] [ENSMUST00000190872]
Predicted Effect probably benign
Transcript: ENSMUST00000023918
AA Change: T489M

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023918
Gene: ENSMUSG00000023150
AA Change: T489M

DomainStartEndE-ValueType
BTB 32 129 1.89e-25 SMART
BACK 134 233 3.39e-8 SMART
low complexity region 325 338 N/A INTRINSIC
Kelch 369 415 4.78e-15 SMART
Kelch 416 463 2.16e-13 SMART
Kelch 464 512 2.15e-8 SMART
Kelch 513 559 1.58e-15 SMART
Kelch 560 606 1.61e-12 SMART
Kelch 607 641 1.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097543
AA Change: T447M

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095150
Gene: ENSMUSG00000023150
AA Change: T447M

DomainStartEndE-ValueType
BTB 32 129 1.89e-25 SMART
Pfam:BACK 134 189 3.3e-8 PFAM
low complexity region 283 296 N/A INTRINSIC
Kelch 327 373 4.78e-15 SMART
Kelch 374 421 2.16e-13 SMART
Kelch 422 470 2.15e-8 SMART
Kelch 471 517 1.58e-15 SMART
Kelch 518 564 1.61e-12 SMART
Kelch 565 599 1.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111887
SMART Domains Protein: ENSMUSP00000107518
Gene: ENSMUSG00000023150

DomainStartEndE-ValueType
BTB 32 129 1.89e-25 SMART
BACK 134 219 7.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186745
SMART Domains Protein: ENSMUSP00000140708
Gene: ENSMUSG00000023150

DomainStartEndE-ValueType
BTB 32 129 1.89e-25 SMART
BACK 134 219 7.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190872
SMART Domains Protein: ENSMUSP00000140332
Gene: ENSMUSG00000023150

DomainStartEndE-ValueType
Kelch 22 68 5.3e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit some early lethality, increased cellular sensitivity to cytochalasin and doxorubicin, and doxorubicin-induced cardiotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Ivns1abp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ivns1abp APN 1 151351112 splice site probably null
IGL01616:Ivns1abp APN 1 151361543 missense possibly damaging 0.69
IGL02061:Ivns1abp APN 1 151351573 missense probably damaging 0.97
IGL02630:Ivns1abp APN 1 151359635 missense probably damaging 1.00
H8562:Ivns1abp UTSW 1 151354695 missense probably damaging 0.98
PIT1430001:Ivns1abp UTSW 1 151361605 missense probably damaging 1.00
R0107:Ivns1abp UTSW 1 151361570 missense probably damaging 0.99
R0609:Ivns1abp UTSW 1 151360145 missense probably benign 0.02
R1104:Ivns1abp UTSW 1 151360109 missense probably benign 0.42
R1463:Ivns1abp UTSW 1 151361540 missense probably benign 0.05
R1512:Ivns1abp UTSW 1 151360936 missense possibly damaging 0.87
R1512:Ivns1abp UTSW 1 151360937 missense probably benign 0.02
R1521:Ivns1abp UTSW 1 151351558 missense probably damaging 1.00
R1550:Ivns1abp UTSW 1 151361491 missense probably damaging 1.00
R2047:Ivns1abp UTSW 1 151351631 missense possibly damaging 0.83
R2435:Ivns1abp UTSW 1 151363310 missense probably benign 0.04
R5011:Ivns1abp UTSW 1 151363202 missense possibly damaging 0.76
R5667:Ivns1abp UTSW 1 151354009 missense probably benign 0.01
R5671:Ivns1abp UTSW 1 151354009 missense probably benign 0.01
R6505:Ivns1abp UTSW 1 151360993 missense probably benign 0.00
Z1176:Ivns1abp UTSW 1 151351033 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAACCGTTGTAATGCAGG -3'
(R):5'- GGCAAACCAGGATTATTATTACAGC -3'

Sequencing Primer
(F):5'- CCGTTGTAATGCAGGTAATAACACTC -3'
(R):5'- CAGCTATCAAAACTGTAAATGTGTAC -3'
Posted On2015-07-21