Incidental Mutation 'R4471:Rin2'
ID 329409
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene Name Ras and Rab interactor 2
Synonyms 2010003K16Rik, RASSF4, 4632403N06Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 145613647-145729536 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145702366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
AlphaFold Q9D684
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145,701,926 (GRCm39) splice site probably benign
IGL03222:Rin2 APN 2 145,702,115 (GRCm39) nonsense probably null
IGL03371:Rin2 APN 2 145,727,846 (GRCm39) utr 3 prime probably benign
IGL03411:Rin2 APN 2 145,702,864 (GRCm39) missense probably damaging 0.99
D4043:Rin2 UTSW 2 145,664,283 (GRCm39) missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145,720,752 (GRCm39) splice site probably benign
R0110:Rin2 UTSW 2 145,702,953 (GRCm39) missense probably benign
R0144:Rin2 UTSW 2 145,718,559 (GRCm39) missense probably damaging 0.96
R0510:Rin2 UTSW 2 145,702,953 (GRCm39) missense probably benign
R1326:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1327:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1328:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1329:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1330:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1544:Rin2 UTSW 2 145,700,366 (GRCm39) missense probably damaging 1.00
R1658:Rin2 UTSW 2 145,718,376 (GRCm39) missense probably benign 0.04
R1832:Rin2 UTSW 2 145,703,091 (GRCm39) missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145,720,860 (GRCm39) missense probably damaging 1.00
R2137:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2167:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2170:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2260:Rin2 UTSW 2 145,720,824 (GRCm39) missense probably damaging 0.97
R2312:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2884:Rin2 UTSW 2 145,702,911 (GRCm39) missense probably benign 0.07
R3155:Rin2 UTSW 2 145,702,771 (GRCm39) missense probably benign 0.17
R3771:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3772:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3773:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3822:Rin2 UTSW 2 145,664,550 (GRCm39) missense probably benign 0.02
R3824:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3825:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3885:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3893:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3939:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3940:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4012:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4019:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4058:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4214:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4231:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4232:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4236:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4372:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4410:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4415:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4490:Rin2 UTSW 2 145,664,194 (GRCm39) missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145,702,825 (GRCm39) missense probably benign 0.01
R5099:Rin2 UTSW 2 145,720,821 (GRCm39) missense probably damaging 1.00
R5268:Rin2 UTSW 2 145,686,680 (GRCm39) missense probably benign
R5493:Rin2 UTSW 2 145,702,629 (GRCm39) missense probably damaging 1.00
R5622:Rin2 UTSW 2 145,702,299 (GRCm39) missense probably benign 0.07
R5947:Rin2 UTSW 2 145,686,863 (GRCm39) intron probably benign
R6280:Rin2 UTSW 2 145,702,939 (GRCm39) missense probably damaging 1.00
R7009:Rin2 UTSW 2 145,725,395 (GRCm39) missense probably damaging 1.00
R7531:Rin2 UTSW 2 145,700,419 (GRCm39) missense probably benign
R7824:Rin2 UTSW 2 145,703,037 (GRCm39) missense probably benign 0.00
R8065:Rin2 UTSW 2 145,702,977 (GRCm39) missense probably damaging 0.99
R8067:Rin2 UTSW 2 145,702,977 (GRCm39) missense probably damaging 0.99
R8144:Rin2 UTSW 2 145,664,225 (GRCm39) missense probably benign
R8510:Rin2 UTSW 2 145,727,611 (GRCm39) missense probably damaging 1.00
R8853:Rin2 UTSW 2 145,718,475 (GRCm39) missense possibly damaging 0.68
R8880:Rin2 UTSW 2 145,690,772 (GRCm39) missense probably damaging 1.00
R9224:Rin2 UTSW 2 145,720,822 (GRCm39) nonsense probably null
R9325:Rin2 UTSW 2 145,727,819 (GRCm39) missense probably benign 0.15
R9417:Rin2 UTSW 2 145,686,713 (GRCm39) missense probably benign 0.02
R9555:Rin2 UTSW 2 145,718,415 (GRCm39) nonsense probably null
R9631:Rin2 UTSW 2 145,718,437 (GRCm39) missense probably damaging 1.00
R9667:Rin2 UTSW 2 145,702,202 (GRCm39) missense possibly damaging 0.89
R9691:Rin2 UTSW 2 145,690,764 (GRCm39) missense probably damaging 0.97
R9727:Rin2 UTSW 2 145,702,506 (GRCm39) missense possibly damaging 0.94
R9780:Rin2 UTSW 2 145,718,551 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAAGTGCACAGCCAGGAC -3'
(R):5'- GAAAGGCTCATGTCGCTCAG -3'

Sequencing Primer
(F):5'- AGGACTCCCAACGCGAATGG -3'
(R):5'- TGTGATTCAGAGCCGGGC -3'
Posted On 2015-07-21