Incidental Mutation 'R4471:Celf3'
ID 329410
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene Name CUGBP, Elav-like family member 3
Synonyms BRUNOL1, Tnrc4, CAGH4, ERDA4, 4930415M08Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R4471 (G1)
Quality Score 214
Status Validated
Chromosome 3
Chromosomal Location 94385602-94399505 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 94395585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000200342] [ENSMUST00000199775] [ENSMUST00000199775] [ENSMUST00000198384] [ENSMUST00000199884]
AlphaFold Q8CIN6
Predicted Effect probably null
Transcript: ENSMUST00000029784
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably benign
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect probably null
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200342
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199775
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199775
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably benign
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94,395,535 (GRCm39) missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94,394,108 (GRCm39) missense probably damaging 1.00
IGL03007:Celf3 APN 3 94,394,444 (GRCm39) missense probably benign 0.00
R0180:Celf3 UTSW 3 94,392,647 (GRCm39) missense probably damaging 1.00
R0670:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R1965:Celf3 UTSW 3 94,392,634 (GRCm39) missense probably damaging 1.00
R2232:Celf3 UTSW 3 94,387,566 (GRCm39) splice site probably null
R2566:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R3546:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3547:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R3548:Celf3 UTSW 3 94,395,845 (GRCm39) missense probably damaging 1.00
R4015:Celf3 UTSW 3 94,394,505 (GRCm39) missense probably benign 0.02
R4698:Celf3 UTSW 3 94,392,174 (GRCm39) critical splice donor site probably null
R4816:Celf3 UTSW 3 94,386,529 (GRCm39) missense probably damaging 1.00
R4939:Celf3 UTSW 3 94,395,537 (GRCm39) small deletion probably benign
R5851:Celf3 UTSW 3 94,386,433 (GRCm39) missense probably damaging 1.00
R6277:Celf3 UTSW 3 94,392,672 (GRCm39) missense probably damaging 1.00
R6400:Celf3 UTSW 3 94,387,593 (GRCm39) missense probably damaging 1.00
R6986:Celf3 UTSW 3 94,395,024 (GRCm39) missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94,387,637 (GRCm39) missense probably damaging 0.99
R7556:Celf3 UTSW 3 94,387,590 (GRCm39) missense probably damaging 1.00
R8141:Celf3 UTSW 3 94,395,850 (GRCm39) missense probably damaging 1.00
R8290:Celf3 UTSW 3 94,386,489 (GRCm39) missense probably benign 0.44
R8978:Celf3 UTSW 3 94,392,667 (GRCm39) missense probably benign 0.22
R9255:Celf3 UTSW 3 94,392,594 (GRCm39) missense probably benign 0.25
R9636:Celf3 UTSW 3 94,394,580 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCTCTAGGCCTGTGGATTC -3'
(R):5'- AGATGTTGCAGCCATCAGGG -3'

Sequencing Primer
(F):5'- TTGTGCCGAGTCAGGGGAAC -3'
(R):5'- CTGGGAAGTGCAGACTGC -3'
Posted On 2015-07-21