Incidental Mutation 'R4471:Alpk1'
ID 329411
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Name alpha-kinase 1
Synonyms 8430410J10Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 127463959-127574176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127473175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 943 (S943P)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029662
AA Change: S943P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: S943P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159720
AA Change: F181S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably damaging
Transcript: ENSMUST00000198955
AA Change: S943P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: S943P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127,474,692 (GRCm39) missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127,473,862 (GRCm39) missense probably benign 0.00
IGL01066:Alpk1 APN 3 127,473,874 (GRCm39) missense probably benign 0.22
IGL01351:Alpk1 APN 3 127,466,011 (GRCm39) missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127,473,621 (GRCm39) missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127,471,401 (GRCm39) splice site probably null
IGL01585:Alpk1 APN 3 127,473,462 (GRCm39) missense probably benign 0.01
IGL02308:Alpk1 APN 3 127,522,931 (GRCm39) missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127,473,552 (GRCm39) missense probably benign 0.43
IGL02458:Alpk1 APN 3 127,474,968 (GRCm39) critical splice donor site probably null
IGL02553:Alpk1 APN 3 127,466,970 (GRCm39) missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127,474,749 (GRCm39) missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127,474,721 (GRCm39) missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127,473,592 (GRCm39) missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127,473,771 (GRCm39) missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127,473,870 (GRCm39) nonsense probably null
R0427:Alpk1 UTSW 3 127,464,720 (GRCm39) missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127,473,051 (GRCm39) missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127,474,459 (GRCm39) missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127,471,447 (GRCm39) missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127,474,749 (GRCm39) missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127,477,239 (GRCm39) missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127,474,569 (GRCm39) missense probably benign 0.01
R2373:Alpk1 UTSW 3 127,473,457 (GRCm39) missense probably benign 0.00
R3803:Alpk1 UTSW 3 127,473,486 (GRCm39) missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127,471,365 (GRCm39) missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127,473,175 (GRCm39) missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127,478,120 (GRCm39) intron probably benign
R4594:Alpk1 UTSW 3 127,477,203 (GRCm39) missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127,473,507 (GRCm39) missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127,464,708 (GRCm39) missense probably benign 0.06
R4887:Alpk1 UTSW 3 127,467,124 (GRCm39) missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127,478,969 (GRCm39) splice site probably benign
R5169:Alpk1 UTSW 3 127,464,750 (GRCm39) missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127,474,813 (GRCm39) missense probably benign 0.00
R5351:Alpk1 UTSW 3 127,522,941 (GRCm39) missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127,471,368 (GRCm39) missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127,474,296 (GRCm39) missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127,473,684 (GRCm39) missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127,474,618 (GRCm39) missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127,473,723 (GRCm39) missense probably benign 0.06
R5940:Alpk1 UTSW 3 127,464,595 (GRCm39) missense probably benign
R6187:Alpk1 UTSW 3 127,466,991 (GRCm39) missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127,479,965 (GRCm39) missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127,473,858 (GRCm39) missense probably benign
R6701:Alpk1 UTSW 3 127,522,985 (GRCm39) missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127,518,098 (GRCm39) missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127,523,012 (GRCm39) missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R7258:Alpk1 UTSW 3 127,518,115 (GRCm39) missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127,489,382 (GRCm39) missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127,466,143 (GRCm39) missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127,473,427 (GRCm39) missense probably benign 0.22
R7635:Alpk1 UTSW 3 127,489,310 (GRCm39) missense probably benign 0.01
R7660:Alpk1 UTSW 3 127,474,616 (GRCm39) missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127,466,195 (GRCm39) missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127,478,041 (GRCm39) missense
R7827:Alpk1 UTSW 3 127,473,700 (GRCm39) missense probably benign 0.00
R8029:Alpk1 UTSW 3 127,522,934 (GRCm39) missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127,518,085 (GRCm39) missense probably benign 0.41
R8478:Alpk1 UTSW 3 127,522,961 (GRCm39) missense probably damaging 1.00
R8765:Alpk1 UTSW 3 127,466,118 (GRCm39) missense probably damaging 1.00
R8816:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R8907:Alpk1 UTSW 3 127,474,642 (GRCm39) nonsense probably null
R8972:Alpk1 UTSW 3 127,473,232 (GRCm39) missense probably damaging 1.00
R8974:Alpk1 UTSW 3 127,473,580 (GRCm39) missense probably benign 0.03
R9039:Alpk1 UTSW 3 127,473,192 (GRCm39) missense probably damaging 1.00
R9202:Alpk1 UTSW 3 127,479,938 (GRCm39) missense
R9394:Alpk1 UTSW 3 127,466,187 (GRCm39) missense probably damaging 1.00
R9421:Alpk1 UTSW 3 127,467,069 (GRCm39) missense probably damaging 1.00
R9436:Alpk1 UTSW 3 127,478,924 (GRCm39) missense
R9785:Alpk1 UTSW 3 127,473,594 (GRCm39) missense probably benign 0.22
Z1176:Alpk1 UTSW 3 127,467,087 (GRCm39) missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127,478,956 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTTCCCTAAAACCTGGAGC -3'
(R):5'- TGTAAATGGCTCCAGTCCTTCC -3'

Sequencing Primer
(F):5'- AACTGGGAGGGTTGTACTCAC -3'
(R):5'- CCCTATCTTCGATGAGGACTTCAG -3'
Posted On 2015-07-21