Incidental Mutation 'R4471:Cyp2j12'
ID 329416
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Name cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms OTTMUSG00000007939, Cyp2j12-ps
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 96099318-96141152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96133069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000121694]
AlphaFold G3UXT0
Predicted Effect probably benign
Transcript: ENSMUST00000097972
AA Change: V100A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225
AA Change: V100A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 96106589 splice site probably benign
IGL01655:Cyp2j12 APN 4 96115577 missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 96102126 missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96122658 makesense probably null
IGL01936:Cyp2j12 APN 4 96133069 missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 96099762 missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96132994 critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96141025 missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 96102079 missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96112862 splice site probably benign
R1016:Cyp2j12 UTSW 4 96112865 critical splice donor site probably null
R1251:Cyp2j12 UTSW 4 96115666 nonsense probably null
R1753:Cyp2j12 UTSW 4 96121432 splice site probably null
R2258:Cyp2j12 UTSW 4 96133078 missense probably damaging 1.00
R4559:Cyp2j12 UTSW 4 96112957 missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96132993 critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 96102109 missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 96102151 splice site probably null
R5591:Cyp2j12 UTSW 4 96141122 start gained probably benign
R5897:Cyp2j12 UTSW 4 96102042 missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96140837 missense probably damaging 0.99
R6942:Cyp2j12 UTSW 4 96112864 critical splice donor site probably null
R7422:Cyp2j12 UTSW 4 96140985 missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 96102126 missense possibly damaging 0.95
R7839:Cyp2j12 UTSW 4 96099656 missense possibly damaging 0.94
R8437:Cyp2j12 UTSW 4 96099662 missense probably damaging 1.00
R8445:Cyp2j12 UTSW 4 96133022 missense possibly damaging 0.82
R8683:Cyp2j12 UTSW 4 96121568 missense probably benign 0.41
R8701:Cyp2j12 UTSW 4 96121573 missense possibly damaging 0.81
R8864:Cyp2j12 UTSW 4 96121513 missense probably damaging 1.00
R8924:Cyp2j12 UTSW 4 96106448 missense probably damaging 1.00
R9330:Cyp2j12 UTSW 4 96106554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTGACATACCATGCACATGC -3'
(R):5'- TACACCTCTAAACACTAGTCTGTC -3'

Sequencing Primer
(F):5'- CATGAAACTTTTCCAGACCTGTG -3'
(R):5'- TCTGTCTAAATACACACACACATCTG -3'
Posted On 2015-07-21