Incidental Mutation 'R4471:Zfp979'
ID 329419
Institutional Source Beutler Lab
Gene Symbol Zfp979
Ensembl Gene ENSMUSG00000066000
Gene Name zinc finger protein 979
Synonyms 2610305D13Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R4471 (G1)
Quality Score 181
Status Validated
Chromosome 4
Chromosomal Location 147611937-147642513 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 147613456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 265 (C265*)
Ref Sequence ENSEMBL: ENSMUSP00000101345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037565] [ENSMUST00000105720] [ENSMUST00000133006]
AlphaFold A2A799
Predicted Effect probably null
Transcript: ENSMUST00000037565
AA Change: C265*
SMART Domains Protein: ENSMUSP00000038153
Gene: ENSMUSG00000066000
AA Change: C265*

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105720
AA Change: C265*
SMART Domains Protein: ENSMUSP00000101345
Gene: ENSMUSG00000066000
AA Change: C265*

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133006
SMART Domains Protein: ENSMUSP00000114677
Gene: ENSMUSG00000066000

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Zfp979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Zfp979 APN 4 147615396 missense probably damaging 0.98
IGL01865:Zfp979 APN 4 147615317 missense probably benign 0.03
IGL02336:Zfp979 APN 4 147615351 missense probably damaging 1.00
R0336:Zfp979 UTSW 4 147613135 missense possibly damaging 0.86
R1365:Zfp979 UTSW 4 147613224 missense probably benign 0.00
R1440:Zfp979 UTSW 4 147614036 missense possibly damaging 0.96
R1714:Zfp979 UTSW 4 147613985 missense probably damaging 1.00
R1796:Zfp979 UTSW 4 147613283 missense probably damaging 0.99
R2155:Zfp979 UTSW 4 147613458 missense possibly damaging 0.86
R3735:Zfp979 UTSW 4 147613482 missense possibly damaging 0.93
R3963:Zfp979 UTSW 4 147613131 missense probably benign 0.34
R3972:Zfp979 UTSW 4 147618419 nonsense probably null
R4983:Zfp979 UTSW 4 147613914 missense possibly damaging 0.94
R5310:Zfp979 UTSW 4 147613918 missense possibly damaging 0.95
R5805:Zfp979 UTSW 4 147613610 missense probably damaging 0.99
R5861:Zfp979 UTSW 4 147613509 nonsense probably null
R6598:Zfp979 UTSW 4 147613766 missense probably damaging 0.99
R6599:Zfp979 UTSW 4 147613626 missense probably benign 0.40
R6925:Zfp979 UTSW 4 147613542 missense possibly damaging 0.86
R7684:Zfp979 UTSW 4 147613342 missense probably damaging 0.99
R7801:Zfp979 UTSW 4 147613978 missense probably damaging 0.96
R8035:Zfp979 UTSW 4 147613306 missense probably damaging 1.00
R8086:Zfp979 UTSW 4 147613547 missense probably damaging 0.99
R8244:Zfp979 UTSW 4 147613476 missense possibly damaging 0.92
R8369:Zfp979 UTSW 4 147613091 missense possibly damaging 0.73
R8880:Zfp979 UTSW 4 147613379 missense probably benign 0.00
R8887:Zfp979 UTSW 4 147613762 missense probably damaging 0.96
R8988:Zfp979 UTSW 4 147613527 missense probably benign
R9016:Zfp979 UTSW 4 147613047 missense possibly damaging 0.68
R9356:Zfp979 UTSW 4 147613901 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTTGGTGGGTAAAGCATTTGTC -3'
(R):5'- CCCATTGTGAGACAAAACAATAGTG -3'

Sequencing Primer
(F):5'- GTGGGTAAAGCATTTGTCACATTCAC -3'
(R):5'- GTGAAATGAACACTTACACTTGTGG -3'
Posted On 2015-07-21