Incidental Mutation 'R4471:Tecrl'
ID 329421
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Name trans-2,3-enoyl-CoA reductase-like
Synonyms Srd5a2l2, D330017N19Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 83278145-83355195 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83313287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 108 (Y108H)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
AlphaFold Q8BFZ1
Predicted Effect probably benign
Transcript: ENSMUST00000053543
AA Change: Y108H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: Y108H

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146669
AA Change: Y93H
SMART Domains Protein: ENSMUSP00000115144
Gene: ENSMUSG00000049537
AA Change: Y93H

DomainStartEndE-ValueType
PDB:2DZJ|A 39 93 1e-11 PDB
transmembrane domain 100 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83294606 missense probably benign
IGL02067:Tecrl APN 5 83284275 missense probably benign 0.05
IGL02111:Tecrl APN 5 83354792 missense probably damaging 1.00
IGL02391:Tecrl APN 5 83354827 missense probably benign 0.00
IGL02860:Tecrl APN 5 83354997 missense probably benign 0.01
IGL03079:Tecrl APN 5 83294600 missense probably damaging 0.96
IGL03109:Tecrl APN 5 83309309 intron probably benign
BB004:Tecrl UTSW 5 83354819 missense probably damaging 1.00
BB014:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R0095:Tecrl UTSW 5 83294570 splice site probably benign
R0347:Tecrl UTSW 5 83294632 missense probably damaging 1.00
R0372:Tecrl UTSW 5 83294659 missense probably damaging 1.00
R0403:Tecrl UTSW 5 83354758 splice site probably benign
R0426:Tecrl UTSW 5 83354763 splice site probably benign
R0597:Tecrl UTSW 5 83354928 nonsense probably null
R1607:Tecrl UTSW 5 83280508 splice site probably null
R1771:Tecrl UTSW 5 83291287 missense probably damaging 1.00
R1800:Tecrl UTSW 5 83279230 missense probably damaging 1.00
R1815:Tecrl UTSW 5 83279234 missense probably benign 0.01
R1869:Tecrl UTSW 5 83354859 missense probably benign 0.00
R1870:Tecrl UTSW 5 83354859 missense probably benign 0.00
R4296:Tecrl UTSW 5 83313327 nonsense probably null
R6281:Tecrl UTSW 5 83294606 missense probably damaging 1.00
R6343:Tecrl UTSW 5 83294600 missense probably damaging 0.96
R6866:Tecrl UTSW 5 83313314 missense probably damaging 1.00
R6948:Tecrl UTSW 5 83309250 missense probably benign
R6971:Tecrl UTSW 5 83354802 missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83354921 missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83279335 missense probably damaging 0.99
R7282:Tecrl UTSW 5 83354907 missense probably benign 0.26
R7444:Tecrl UTSW 5 83355068 unclassified probably benign
R7900:Tecrl UTSW 5 83279341 missense probably benign 0.04
R7927:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R8246:Tecrl UTSW 5 83279309 missense probably damaging 0.99
R8360:Tecrl UTSW 5 83300917 missense probably damaging 1.00
R8466:Tecrl UTSW 5 83280520 nonsense probably null
R8947:Tecrl UTSW 5 83313307 missense probably benign 0.10
R8949:Tecrl UTSW 5 83313307 missense probably benign 0.10
R9009:Tecrl UTSW 5 83284274 missense probably damaging 0.96
R9115:Tecrl UTSW 5 83280059 missense possibly damaging 0.93
R9182:Tecrl UTSW 5 83309202 critical splice donor site probably null
R9320:Tecrl UTSW 5 83280575 missense possibly damaging 0.67
X0019:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0024:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0034:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0035:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0036:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0037:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0038:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0039:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0040:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0052:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0053:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0054:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0058:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0060:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0061:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0062:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0063:Tecrl UTSW 5 83338252 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCTAGAGAATGTTGCATTTTCCCC -3'
(R):5'- GCACTCTTCCAATGAGAATTACTG -3'

Sequencing Primer
(F):5'- GAATGTTGCATTTTCCCCAAATTTC -3'
(R):5'- TTCCAATGAGAATTACTGAGTATGTG -3'
Posted On 2015-07-21