Incidental Mutation 'R4471:Ulk1'
ID 329422
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Name unc-51 like kinase 1
Synonyms Unc51.1
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110932354-110957963 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110937223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 691 (R691Q)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031490
AA Change: R685Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: R685Q

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200299
AA Change: R691Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: R691Q

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110,935,738 (GRCm39) missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110,940,877 (GRCm39) missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110,940,270 (GRCm39) missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110,944,100 (GRCm39) splice site probably null
IGL02415:Ulk1 APN 5 110,935,487 (GRCm39) missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110,957,000 (GRCm39) missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110,940,918 (GRCm39) missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110,935,573 (GRCm39) splice site probably benign
R0092:Ulk1 UTSW 5 110,944,193 (GRCm39) missense probably null 1.00
R0158:Ulk1 UTSW 5 110,936,810 (GRCm39) splice site probably benign
R0387:Ulk1 UTSW 5 110,936,663 (GRCm39) missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110,938,951 (GRCm39) missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110,937,411 (GRCm39) splice site probably benign
R1244:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R1245:Ulk1 UTSW 5 110,937,206 (GRCm39) critical splice donor site probably null
R1268:Ulk1 UTSW 5 110,938,143 (GRCm39) missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R1586:Ulk1 UTSW 5 110,937,382 (GRCm39) missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110,943,632 (GRCm39) missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110,935,697 (GRCm39) missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110,937,247 (GRCm39) missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110,938,936 (GRCm39) missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110,935,017 (GRCm39) missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110,940,302 (GRCm39) missense probably benign 0.27
R2276:Ulk1 UTSW 5 110,936,028 (GRCm39) missense probably benign 0.00
R2310:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2311:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2312:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2760:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2762:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2763:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2764:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R2859:Ulk1 UTSW 5 110,942,495 (GRCm39) missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R3760:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R3761:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R3762:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R3763:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R4334:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R4419:Ulk1 UTSW 5 110,937,223 (GRCm39) missense probably benign 0.03
R4615:Ulk1 UTSW 5 110,936,912 (GRCm39) missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110,936,813 (GRCm39) critical splice donor site probably null
R4820:Ulk1 UTSW 5 110,939,996 (GRCm39) missense probably benign
R4912:Ulk1 UTSW 5 110,935,455 (GRCm39) missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110,938,963 (GRCm39) missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110,938,259 (GRCm39) missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110,956,908 (GRCm39) missense probably damaging 1.00
R7724:Ulk1 UTSW 5 110,940,270 (GRCm39) missense probably benign 0.44
R7751:Ulk1 UTSW 5 110,957,078 (GRCm39) missense probably damaging 1.00
R7823:Ulk1 UTSW 5 110,946,780 (GRCm39) missense probably damaging 1.00
R8379:Ulk1 UTSW 5 110,935,531 (GRCm39) missense probably damaging 1.00
R8489:Ulk1 UTSW 5 110,947,002 (GRCm39) nonsense probably null
R8880:Ulk1 UTSW 5 110,934,288 (GRCm39) missense probably damaging 1.00
R9214:Ulk1 UTSW 5 110,936,663 (GRCm39) missense possibly damaging 0.82
X0025:Ulk1 UTSW 5 110,939,995 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGCTTCAGTCATTTAACCGAC -3'
(R):5'- AGCCCATGGGACTTTCTCAG -3'

Sequencing Primer
(F):5'- AGTCATTTAACCGACTTCTCGAATC -3'
(R):5'- CCATGGGACTTTCTCAGTGCTG -3'
Posted On 2015-07-21