Incidental Mutation 'R4471:Impdh1'
ID 329423
Institutional Source Beutler Lab
Gene Symbol Impdh1
Ensembl Gene ENSMUSG00000003500
Gene Name inosine monophosphate dehydrogenase 1
Synonyms B930086D20Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R4471 (G1)
Quality Score 196
Status Validated
Chromosome 6
Chromosomal Location 29200435-29216363 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 29204631 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 307 (Q307*)
Ref Sequence ENSEMBL: ENSMUSP00000125077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078155] [ENSMUST00000159124] [ENSMUST00000160749] [ENSMUST00000160878] [ENSMUST00000162099] [ENSMUST00000162215] [ENSMUST00000162739]
AlphaFold P50096
Predicted Effect probably null
Transcript: ENSMUST00000078155
AA Change: Q283*
SMART Domains Protein: ENSMUSP00000077289
Gene: ENSMUSG00000003500
AA Change: Q283*

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159124
AA Change: Q283*
SMART Domains Protein: ENSMUSP00000124931
Gene: ENSMUSG00000003500
AA Change: Q283*

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160613
Predicted Effect probably benign
Transcript: ENSMUST00000160749
SMART Domains Protein: ENSMUSP00000125488
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
Pfam:IMPDH 28 84 3.9e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160878
AA Change: Q258*
SMART Domains Protein: ENSMUSP00000124269
Gene: ENSMUSG00000003500
AA Change: Q258*

DomainStartEndE-ValueType
IMPDH 28 479 2.97e-232 SMART
CBS 92 143 6.49e-10 SMART
CBS 159 207 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161654
Predicted Effect probably null
Transcript: ENSMUST00000162099
AA Change: Q283*
SMART Domains Protein: ENSMUSP00000124541
Gene: ENSMUSG00000003500
AA Change: Q283*

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162215
SMART Domains Protein: ENSMUSP00000125235
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 231 5.75e-17 SMART
CBS 161 209 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162242
SMART Domains Protein: ENSMUSP00000123981
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 1 145 2e-11 SMART
low complexity region 165 181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162739
AA Change: Q307*
SMART Domains Protein: ENSMUSP00000125077
Gene: ENSMUSG00000003500
AA Change: Q307*

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
IMPDH 86 558 2e-256 SMART
CBS 171 222 6.49e-10 SMART
CBS 238 286 3.37e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Impdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Impdh1 APN 6 29,203,377 (GRCm39) missense probably damaging 0.97
IGL01642:Impdh1 APN 6 29,207,165 (GRCm39) missense possibly damaging 0.57
IGL02187:Impdh1 APN 6 29,207,086 (GRCm39) splice site probably benign
IGL02294:Impdh1 APN 6 29,205,201 (GRCm39) missense probably benign 0.19
IGL02570:Impdh1 APN 6 29,203,197 (GRCm39) missense probably damaging 1.00
IGL02858:Impdh1 APN 6 29,206,924 (GRCm39) nonsense probably null
IGL02874:Impdh1 APN 6 29,203,155 (GRCm39) missense probably damaging 1.00
steve UTSW 6 29,204,631 (GRCm39) nonsense probably null
R0089:Impdh1 UTSW 6 29,206,325 (GRCm39) missense probably benign
R0855:Impdh1 UTSW 6 29,206,971 (GRCm39) missense probably damaging 1.00
R1331:Impdh1 UTSW 6 29,206,477 (GRCm39) missense probably damaging 0.96
R1797:Impdh1 UTSW 6 29,207,168 (GRCm39) missense probably damaging 0.98
R1824:Impdh1 UTSW 6 29,205,087 (GRCm39) missense probably benign 0.08
R1981:Impdh1 UTSW 6 29,206,450 (GRCm39) missense possibly damaging 0.70
R2076:Impdh1 UTSW 6 29,205,162 (GRCm39) missense probably damaging 0.99
R3841:Impdh1 UTSW 6 29,202,768 (GRCm39) missense probably damaging 0.98
R4020:Impdh1 UTSW 6 29,202,693 (GRCm39) missense probably benign 0.01
R4415:Impdh1 UTSW 6 29,209,221 (GRCm39) missense probably damaging 1.00
R4777:Impdh1 UTSW 6 29,205,201 (GRCm39) missense possibly damaging 0.95
R5783:Impdh1 UTSW 6 29,206,342 (GRCm39) missense possibly damaging 0.66
R5973:Impdh1 UTSW 6 29,207,161 (GRCm39) missense probably damaging 1.00
R7230:Impdh1 UTSW 6 29,206,062 (GRCm39) splice site probably null
R7512:Impdh1 UTSW 6 29,207,168 (GRCm39) missense probably benign 0.22
R8686:Impdh1 UTSW 6 29,216,214 (GRCm39) start gained probably benign
R8893:Impdh1 UTSW 6 29,216,248 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAATCAAGTTCTTGGCCTGGG -3'
(R):5'- TCACTGAGAGGCCCCATTTG -3'

Sequencing Primer
(F):5'- TGCTGTCACCACTGGGGATG -3'
(R):5'- ATTTGCCCGGCACTGAG -3'
Posted On 2015-07-21