Incidental Mutation 'R4471:Hipk2'
ID329424
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Namehomeodomain interacting protein kinase 2
Synonyms1110014O20Rik, Stank, B230339E18Rik
MMRRC Submission 041728-MU
Accession Numbers

Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4471 (G1)
Quality Score151
Status Validated
Chromosome6
Chromosomal Location38694390-38876165 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 38736922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159307
Predicted Effect probably benign
Transcript: ENSMUST00000160360
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160962
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161779
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162359
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype Strain: 3624127; 3487301; 4429497
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38819322 splice site probably benign
IGL00814:Hipk2 APN 6 38818549 missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38818273 missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38818315 missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38819182 missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38818395 missense probably benign 0.05
IGL02028:Hipk2 APN 6 38818756 missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38819134 missense probably benign
IGL02135:Hipk2 APN 6 38818999 missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38703501 missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38818521 missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38698447 missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38729944 missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38748002 splice site probably benign
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0092:Hipk2 UTSW 6 38743229 missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38718931 missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38729989 missense probably benign 0.03
R0617:Hipk2 UTSW 6 38747485 missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38698163 missense probably benign 0.14
R1864:Hipk2 UTSW 6 38718935 critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38818984 nonsense probably null
R1995:Hipk2 UTSW 6 38715974 missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38818785 missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38729915 splice site probably benign
R2384:Hipk2 UTSW 6 38818371 missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38743094 missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38818926 missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38699265 missense probably damaging 1.00
R4724:Hipk2 UTSW 6 38698392 missense probably benign 0.10
R4838:Hipk2 UTSW 6 38818404 missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38819257 missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38730881 missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38818879 missense probably benign 0.06
R5320:Hipk2 UTSW 6 38818277 missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38730042 missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38737473 missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38818875 missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38730867 critical splice donor site probably null
R6309:Hipk2 UTSW 6 38698511 missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38818873 missense probably benign 0.04
R6815:Hipk2 UTSW 6 38818842 missense probably damaging 1.00
R7104:Hipk2 UTSW 6 38818644 missense probably damaging 0.98
R7124:Hipk2 UTSW 6 38818478 nonsense probably null
R7238:Hipk2 UTSW 6 38716057 missense probably benign 0.45
R7712:Hipk2 UTSW 6 38703634 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTTCTTTGGGGACTTATAAGAC -3'
(R):5'- TCCTCTGAGCAAATGTGGGG -3'

Sequencing Primer
(F):5'- CTTTGGGGACTTATAAGACTGGAAG -3'
(R):5'- GCCTGCTAAGAAATTGTAGAACC -3'
Posted On2015-07-21