Incidental Mutation 'R4471:Hipk2'
ID 329424
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Name homeodomain interacting protein kinase 2
Synonyms B230339E18Rik, 1110014O20Rik, Stank
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R4471 (G1)
Quality Score 151
Status Validated
Chromosome 6
Chromosomal Location 38671325-38853099 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 38713857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
AlphaFold Q9QZR5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159307
Predicted Effect probably benign
Transcript: ENSMUST00000160360
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160962
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161779
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162359
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38,796,257 (GRCm39) splice site probably benign
IGL00814:Hipk2 APN 6 38,795,484 (GRCm39) missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38,795,208 (GRCm39) missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38,795,250 (GRCm39) missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38,796,117 (GRCm39) missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38,795,330 (GRCm39) missense probably benign 0.05
IGL02028:Hipk2 APN 6 38,795,691 (GRCm39) missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38,796,069 (GRCm39) missense probably benign
IGL02135:Hipk2 APN 6 38,795,934 (GRCm39) missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38,680,436 (GRCm39) missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38,795,456 (GRCm39) missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38,675,382 (GRCm39) missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38,706,879 (GRCm39) missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38,724,937 (GRCm39) splice site probably benign
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0092:Hipk2 UTSW 6 38,720,164 (GRCm39) missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38,695,866 (GRCm39) missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38,706,924 (GRCm39) missense probably benign 0.03
R0617:Hipk2 UTSW 6 38,724,420 (GRCm39) missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38,675,098 (GRCm39) missense probably benign 0.14
R1864:Hipk2 UTSW 6 38,695,870 (GRCm39) critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R1995:Hipk2 UTSW 6 38,692,909 (GRCm39) missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38,795,720 (GRCm39) missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38,706,850 (GRCm39) splice site probably benign
R2384:Hipk2 UTSW 6 38,795,306 (GRCm39) missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38,720,029 (GRCm39) missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38,795,861 (GRCm39) missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38,676,200 (GRCm39) missense probably damaging 1.00
R4724:Hipk2 UTSW 6 38,675,327 (GRCm39) missense probably benign 0.10
R4838:Hipk2 UTSW 6 38,795,339 (GRCm39) missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38,796,192 (GRCm39) missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38,707,816 (GRCm39) missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38,795,814 (GRCm39) missense probably benign 0.06
R5320:Hipk2 UTSW 6 38,795,212 (GRCm39) missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38,706,977 (GRCm39) missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38,714,408 (GRCm39) missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38,795,810 (GRCm39) missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38,707,802 (GRCm39) critical splice donor site probably null
R6309:Hipk2 UTSW 6 38,675,446 (GRCm39) missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38,795,808 (GRCm39) missense probably benign 0.04
R6815:Hipk2 UTSW 6 38,795,777 (GRCm39) missense probably damaging 1.00
R7104:Hipk2 UTSW 6 38,795,579 (GRCm39) missense probably damaging 0.98
R7124:Hipk2 UTSW 6 38,795,413 (GRCm39) nonsense probably null
R7238:Hipk2 UTSW 6 38,692,992 (GRCm39) missense probably benign 0.45
R7712:Hipk2 UTSW 6 38,680,569 (GRCm39) missense probably benign 0.02
R7994:Hipk2 UTSW 6 38,795,403 (GRCm39) missense possibly damaging 0.94
R8190:Hipk2 UTSW 6 38,795,728 (GRCm39) missense possibly damaging 0.88
R8388:Hipk2 UTSW 6 38,722,630 (GRCm39) missense probably damaging 1.00
R8796:Hipk2 UTSW 6 38,675,158 (GRCm39) missense probably damaging 0.99
R9041:Hipk2 UTSW 6 38,724,909 (GRCm39) nonsense probably null
R9388:Hipk2 UTSW 6 38,707,956 (GRCm39) missense probably damaging 1.00
R9480:Hipk2 UTSW 6 38,680,377 (GRCm39) missense probably benign 0.37
R9485:Hipk2 UTSW 6 38,680,445 (GRCm39) missense possibly damaging 0.94
R9562:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
R9565:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTCTTTGGGGACTTATAAGAC -3'
(R):5'- TCCTCTGAGCAAATGTGGGG -3'

Sequencing Primer
(F):5'- CTTTGGGGACTTATAAGACTGGAAG -3'
(R):5'- GCCTGCTAAGAAATTGTAGAACC -3'
Posted On 2015-07-21