Incidental Mutation 'R4471:Ceacam1'
ID329428
Institutional Source Beutler Lab
Gene Symbol Ceacam1
Ensembl Gene ENSMUSG00000074272
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 1
SynonymsCea1, C-CAM, Cc1, Hv2, CD66a, Cea-7, Cea7, Mhv-1, Hv-2, MHVR1, mmCGM1, mCEA1, Bgp1, mmCGM2, Bgp, Cea-1
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25461707-25477603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25474600 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 210 (N210I)
Ref Sequence ENSEMBL: ENSMUSP00000096266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098666] [ENSMUST00000098668] [ENSMUST00000098669] [ENSMUST00000205308] [ENSMUST00000206171] [ENSMUST00000206583] [ENSMUST00000206676] [ENSMUST00000206687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098666
AA Change: N210I

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096263
Gene: ENSMUSG00000074272
AA Change: N210I

DomainStartEndE-ValueType
Pfam:V-set 18 140 1e-21 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098668
SMART Domains Protein: ENSMUSP00000096265
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
Pfam:V-set 12 140 2.4e-21 PFAM
IGc2 157 221 8.37e-15 SMART
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098669
AA Change: N210I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272
AA Change: N210I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205308
Predicted Effect possibly damaging
Transcript: ENSMUST00000206171
AA Change: N210I

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206483
Predicted Effect probably benign
Transcript: ENSMUST00000206583
AA Change: N210I

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000206676
AA Change: N210I

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000206687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206981
Meta Mutation Damage Score 0.4369 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice lacking appreciable levels of the two isoforms containing 4 Ig domains and having increased levels of the two isoforms containing 2 Ig domains are viable and fertile. They are significantly more resistant to mouse hepatitis virus than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Ceacam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Ceacam1 APN 7 25471914 missense possibly damaging 0.86
IGL01766:Ceacam1 APN 7 25471995 missense probably damaging 1.00
IGL02094:Ceacam1 APN 7 25474543 missense probably damaging 1.00
IGL02869:Ceacam1 APN 7 25476541 missense probably benign 0.07
IGL03325:Ceacam1 APN 7 25476487 missense possibly damaging 0.83
PIT4445001:Ceacam1 UTSW 7 25476456 missense probably damaging 1.00
PIT4810001:Ceacam1 UTSW 7 25471975 missense probably damaging 1.00
R0464:Ceacam1 UTSW 7 25472017 missense possibly damaging 0.64
R1270:Ceacam1 UTSW 7 25466314 splice site probably null
R1771:Ceacam1 UTSW 7 25472044 missense probably benign 0.17
R1819:Ceacam1 UTSW 7 25463860 missense possibly damaging 0.68
R1964:Ceacam1 UTSW 7 25474708 missense probably benign 0.13
R2048:Ceacam1 UTSW 7 25476688 missense probably benign 0.09
R2760:Ceacam1 UTSW 7 25477474 missense probably damaging 0.99
R2857:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R2859:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R3546:Ceacam1 UTSW 7 25471914 missense probably benign 0.07
R4606:Ceacam1 UTSW 7 25474526 missense probably damaging 0.97
R4810:Ceacam1 UTSW 7 25474520 makesense probably null
R5291:Ceacam1 UTSW 7 25471831 missense probably damaging 0.99
R5405:Ceacam1 UTSW 7 25463865 missense probably benign 0.41
R5423:Ceacam1 UTSW 7 25474526 missense probably benign 0.01
R5851:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.70
R5967:Ceacam1 UTSW 7 25474742 missense probably damaging 0.97
R6216:Ceacam1 UTSW 7 25471996 missense probably benign 0.19
R6235:Ceacam1 UTSW 7 25471792 splice site probably null
R6323:Ceacam1 UTSW 7 25474651 missense probably damaging 1.00
R6545:Ceacam1 UTSW 7 25473854 missense probably damaging 1.00
R7371:Ceacam1 UTSW 7 25474720 missense possibly damaging 0.95
R7760:Ceacam1 UTSW 7 25472025 missense probably damaging 1.00
R7790:Ceacam1 UTSW 7 25473950 missense probably damaging 1.00
R7869:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
R7952:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
X0028:Ceacam1 UTSW 7 25476420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATGAACCCAGAAGCG -3'
(R):5'- CCACACAGGGCAATCTTCTC -3'

Sequencing Primer
(F):5'- CAGAAGCGAATGTGTGTCCC -3'
(R):5'- TCTGCACAGCCATATTATTAAAGCC -3'
Posted On2015-07-21