Incidental Mutation 'R4471:Unc45a'
ID329430
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4471 (G1)
Quality Score207
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80332980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 399 (I399T)
Ref Sequence ENSEMBL: ENSMUSP00000102991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000133728] [ENSMUST00000154428]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032748
AA Change: I399T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: I399T

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107368
AA Change: I399T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: I399T

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133728
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154428
AA Change: I399T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: I399T

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Meta Mutation Damage Score 0.4488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 intron probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGCTCAGGAGTTCCCATCTTAAA -3'
(R):5'- CAGGTCTGAAGAAGATTCTGGA -3'

Sequencing Primer
(F):5'- CATGGCTGTCTCAACATGTAAGC -3'
(R):5'- TCTGAAGAAGATTCTGGAGGTGG -3'
Posted On2015-07-21