Incidental Mutation 'R4471:Asah1'
ID329433
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene NameN-acylsphingosine amidohydrolase 1
Synonymsacid ceramidase, 2310081N20Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41340197-41374773 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 41343724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000034000] [ENSMUST00000110417]
Predicted Effect probably null
Transcript: ENSMUST00000034000
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034000
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131796
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41349543 unclassified probably benign
IGL02512:Asah1 APN 8 41360307 intron probably benign
IGL02523:Asah1 APN 8 41351947 missense probably benign
IGL03115:Asah1 APN 8 41360299 missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41346196 splice site probably benign
PIT4366001:Asah1 UTSW 8 41343746 missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41349582 missense probably benign 0.02
R1451:Asah1 UTSW 8 41354012 critical splice donor site probably null
R1977:Asah1 UTSW 8 41343517 critical splice donor site probably null
R2200:Asah1 UTSW 8 41343728 critical splice donor site probably null
R3429:Asah1 UTSW 8 41351888 unclassified probably benign
R4002:Asah1 UTSW 8 41348139 splice site probably benign
R4078:Asah1 UTSW 8 41354082 missense probably damaging 0.99
R4470:Asah1 UTSW 8 41343724 splice site probably null
R4968:Asah1 UTSW 8 41354030 missense possibly damaging 0.89
R4970:Asah1 UTSW 8 41360277 nonsense probably null
R5643:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41354055 missense probably damaging 1.00
R6419:Asah1 UTSW 8 41343766 missense probably damaging 1.00
R7059:Asah1 UTSW 8 41347069 missense probably damaging 0.96
R7442:Asah1 UTSW 8 41343565 missense possibly damaging 0.60
R7587:Asah1 UTSW 8 41374541 missense probably benign 0.43
R7663:Asah1 UTSW 8 41341627 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTCTGCGGTCATCAATAAAC -3'
(R):5'- AGGACTGCTGATACCTGTTTCC -3'

Sequencing Primer
(F):5'- TCTGCGGTCATCAATAAACAAGGTG -3'
(R):5'- TTAGTTTCTACACCTAAAACACAGC -3'
Posted On2015-07-21