Incidental Mutation 'R4471:Or8d1'
ID 329438
Institutional Source Beutler Lab
Gene Symbol Or8d1
Ensembl Gene ENSMUSG00000047667
Gene Name olfactory receptor family 8 subfamily D member 1
Synonyms GA_x6K02T2PVTD-32550930-32551856, MOR171-9, MTPCR09, Olfr26
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38766356-38767286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38766927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
AlphaFold Q7TRB7
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: S190P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: S190P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.3021 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Or8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Or8d1 APN 9 38,767,095 (GRCm39) missense probably benign 0.00
IGL01909:Or8d1 APN 9 38,767,013 (GRCm39) nonsense probably null
IGL02146:Or8d1 APN 9 38,766,654 (GRCm39) missense probably benign 0.01
IGL02229:Or8d1 APN 9 38,766,712 (GRCm39) missense possibly damaging 0.62
IGL02382:Or8d1 APN 9 38,766,364 (GRCm39) missense probably benign
IGL03007:Or8d1 APN 9 38,766,592 (GRCm39) missense probably damaging 1.00
IGL03118:Or8d1 APN 9 38,766,526 (GRCm39) missense probably damaging 1.00
PIT4403001:Or8d1 UTSW 9 38,766,676 (GRCm39) missense probably benign 0.39
R0590:Or8d1 UTSW 9 38,766,766 (GRCm39) missense probably damaging 0.99
R0862:Or8d1 UTSW 9 38,766,478 (GRCm39) missense possibly damaging 0.89
R1779:Or8d1 UTSW 9 38,766,846 (GRCm39) missense possibly damaging 0.55
R1796:Or8d1 UTSW 9 38,766,820 (GRCm39) missense probably benign 0.01
R2083:Or8d1 UTSW 9 38,766,637 (GRCm39) missense probably benign 0.10
R3420:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R3421:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R4328:Or8d1 UTSW 9 38,767,132 (GRCm39) missense possibly damaging 0.62
R4470:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R5047:Or8d1 UTSW 9 38,766,585 (GRCm39) missense probably benign 0.36
R5267:Or8d1 UTSW 9 38,767,101 (GRCm39) missense probably damaging 1.00
R5318:Or8d1 UTSW 9 38,766,744 (GRCm39) missense probably damaging 1.00
R6502:Or8d1 UTSW 9 38,766,933 (GRCm39) missense probably damaging 0.99
R7221:Or8d1 UTSW 9 38,766,538 (GRCm39) missense probably damaging 1.00
R7297:Or8d1 UTSW 9 38,767,245 (GRCm39) missense probably damaging 1.00
R7448:Or8d1 UTSW 9 38,766,412 (GRCm39) missense probably damaging 1.00
R7525:Or8d1 UTSW 9 38,766,534 (GRCm39) missense possibly damaging 0.89
R8040:Or8d1 UTSW 9 38,766,460 (GRCm39) missense probably damaging 0.99
R8303:Or8d1 UTSW 9 38,766,837 (GRCm39) missense probably damaging 1.00
R8972:Or8d1 UTSW 9 38,767,254 (GRCm39) missense probably damaging 1.00
Z1177:Or8d1 UTSW 9 38,766,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCCATGGCGTATGATC -3'
(R):5'- CACAGCCATAAGATGAGAGCTG -3'

Sequencing Primer
(F):5'- ATCGCTATGTGGCCATCTGTAGAC -3'
(R):5'- AGCTGCAGGTTCCAAAGGATTTG -3'
Posted On 2015-07-21