Incidental Mutation 'R4471:Slc5a4b'
ID 329443
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Name solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms SGLT3b, pSGLT2, 2010104G07Rik, SAAT1
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 75894452-75946852 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 75894725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 594 (Q594*)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
AlphaFold Q91ZP4
Predicted Effect probably null
Transcript: ENSMUST00000120757
AA Change: Q594*
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: Q594*

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rexo1 A T 10: 80,378,492 (GRCm39) S476T probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 75,906,422 (GRCm39) missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 75,906,329 (GRCm39) splice site probably benign
IGL01754:Slc5a4b APN 10 75,906,449 (GRCm39) missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 75,896,260 (GRCm39) missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 75,896,188 (GRCm39) missense probably benign 0.01
IGL02211:Slc5a4b APN 10 75,896,297 (GRCm39) splice site probably benign
IGL02254:Slc5a4b APN 10 75,896,264 (GRCm39) missense probably benign
IGL02389:Slc5a4b APN 10 75,908,299 (GRCm39) nonsense probably null
IGL02427:Slc5a4b APN 10 75,894,713 (GRCm39) missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 75,910,849 (GRCm39) missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 75,946,685 (GRCm39) missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 75,910,934 (GRCm39) missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 75,906,462 (GRCm39) missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 75,898,117 (GRCm39) missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 75,917,161 (GRCm39) missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 75,926,534 (GRCm39) missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 75,899,870 (GRCm39) missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 75,917,341 (GRCm39) missense probably benign 0.09
R0975:Slc5a4b UTSW 10 75,917,241 (GRCm39) missense probably benign 0.09
R1934:Slc5a4b UTSW 10 75,917,307 (GRCm39) missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 75,944,383 (GRCm39) missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 75,910,907 (GRCm39) missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 75,917,358 (GRCm39) missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 75,898,094 (GRCm39) missense probably benign 0.01
R4012:Slc5a4b UTSW 10 75,910,826 (GRCm39) missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4667:Slc5a4b UTSW 10 75,910,879 (GRCm39) missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 75,898,073 (GRCm39) missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 75,917,301 (GRCm39) missense probably benign 0.44
R5181:Slc5a4b UTSW 10 75,896,221 (GRCm39) nonsense probably null
R5319:Slc5a4b UTSW 10 75,898,233 (GRCm39) missense probably benign 0.08
R6306:Slc5a4b UTSW 10 75,917,185 (GRCm39) missense probably benign 0.01
R6422:Slc5a4b UTSW 10 75,939,696 (GRCm39) missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 75,898,220 (GRCm39) missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 75,925,812 (GRCm39) missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 75,910,943 (GRCm39) missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 75,946,742 (GRCm39) missense probably benign 0.01
R7683:Slc5a4b UTSW 10 75,899,906 (GRCm39) missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 75,906,407 (GRCm39) missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 75,898,133 (GRCm39) missense probably benign 0.19
R7877:Slc5a4b UTSW 10 75,910,886 (GRCm39) missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 75,939,680 (GRCm39) missense possibly damaging 0.93
R8843:Slc5a4b UTSW 10 75,910,925 (GRCm39) missense probably damaging 1.00
R9111:Slc5a4b UTSW 10 75,925,827 (GRCm39) splice site probably benign
R9163:Slc5a4b UTSW 10 75,917,165 (GRCm39) nonsense probably null
R9195:Slc5a4b UTSW 10 75,898,149 (GRCm39) missense probably damaging 1.00
R9600:Slc5a4b UTSW 10 75,896,239 (GRCm39) missense probably damaging 1.00
R9643:Slc5a4b UTSW 10 75,945,896 (GRCm39) missense probably benign 0.01
R9656:Slc5a4b UTSW 10 75,944,391 (GRCm39) missense probably damaging 0.98
R9699:Slc5a4b UTSW 10 75,946,674 (GRCm39) missense probably damaging 0.99
X0019:Slc5a4b UTSW 10 75,946,685 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTTTCTGCTTCCTTCAGGG -3'
(R):5'- ATGTGATCCGCTGTACTATTGG -3'

Sequencing Primer
(F):5'- CTTCCTTCAGGGTTCAGGCAAAATAG -3'
(R):5'- GAAGGTCCGGAGTTCAAATCCC -3'
Posted On 2015-07-21