Incidental Mutation 'R4471:Rexo1'
ID 329444
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene Name REX1, RNA exonuclease 1
Synonyms Rex1, Tceb3bp1, 2610511M11Rik, 1700021P10Rik
MMRRC Submission 041728-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.413) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80376756-80397394 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80378492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 476 (S476T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000057910] [ENSMUST00000183160] [ENSMUST00000220326] [ENSMUST00000219648]
AlphaFold Q7TT28
Predicted Effect probably benign
Transcript: ENSMUST00000020383
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057910
AA Change: S1154T

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: S1154T

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182260
AA Change: S476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182682
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183139
Predicted Effect probably benign
Transcript: ENSMUST00000183160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183233
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Meta Mutation Damage Score 0.3025 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 A G 3: 127,473,175 (GRCm39) S943P probably damaging Het
Ankdd1a T C 9: 65,410,791 (GRCm39) D398G probably damaging Het
Ankrd13b T A 11: 77,367,040 (GRCm39) K49M probably damaging Het
Asah1 A G 8: 41,796,761 (GRCm39) probably null Het
Cdc34b A G 11: 94,633,064 (GRCm39) E88G probably benign Het
Cdh2 T C 18: 16,907,533 (GRCm39) probably null Het
Ceacam1 T A 7: 25,174,025 (GRCm39) N210I possibly damaging Het
Celf3 A G 3: 94,395,585 (GRCm39) probably null Het
Cfap20dc A G 14: 8,536,571 (GRCm38) L212P probably damaging Het
Cmya5 A T 13: 93,228,833 (GRCm39) M2085K probably benign Het
Cpne6 G A 14: 55,754,089 (GRCm39) V469M probably damaging Het
Cyp2j12 A G 4: 96,021,306 (GRCm39) V100A probably benign Het
Dnajb4 A T 3: 151,890,799 (GRCm39) H333Q probably benign Het
Eif3f T C 7: 108,540,153 (GRCm39) V316A possibly damaging Het
Eml1 T C 12: 108,472,894 (GRCm39) probably benign Het
Ern1 C A 11: 106,310,868 (GRCm39) V302L possibly damaging Het
Fam110b A T 4: 5,799,092 (GRCm39) H170L probably benign Het
Fn3krp T G 11: 121,317,499 (GRCm39) D146E probably benign Het
Git1 A G 11: 77,390,650 (GRCm39) T129A probably benign Het
Glrp1 T A 1: 88,431,196 (GRCm39) Q58L unknown Het
Gpatch2 A G 1: 186,965,337 (GRCm39) E281G probably damaging Het
Hipk2 T A 6: 38,713,857 (GRCm39) probably benign Het
Hydin A G 8: 111,313,764 (GRCm39) N4214S probably damaging Het
Icam5 T A 9: 20,946,802 (GRCm39) C443* probably null Het
Impdh1 G A 6: 29,204,631 (GRCm39) Q307* probably null Het
Ivns1abp C T 1: 151,236,990 (GRCm39) T447M probably benign Het
Lman1 A T 18: 66,124,797 (GRCm39) probably benign Het
Mdn1 A G 4: 32,668,860 (GRCm39) E306G probably benign Het
Msc G C 1: 14,825,902 (GRCm39) P24R probably damaging Het
Mtif2 T C 11: 29,490,053 (GRCm39) probably benign Het
Mvp C T 7: 126,601,130 (GRCm39) M1I probably null Het
Myh7 A T 14: 55,229,311 (GRCm39) Y162* probably null Het
Nemf G A 12: 69,361,216 (GRCm39) H956Y probably benign Het
Nktr T C 9: 121,577,962 (GRCm39) probably benign Het
Nrxn3 T C 12: 90,171,515 (GRCm39) S276P probably damaging Het
Or8d1 T C 9: 38,766,927 (GRCm39) S190P probably damaging Het
Patj A G 4: 98,423,816 (GRCm39) K621E probably damaging Het
Prss2 A G 6: 41,499,780 (GRCm39) I24V probably damaging Het
R3hcc1l T C 19: 42,571,259 (GRCm39) probably benign Het
Rest T C 5: 77,429,027 (GRCm39) V482A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc16a3 T C 11: 120,846,774 (GRCm39) probably benign Het
Slc5a4b G A 10: 75,894,725 (GRCm39) Q594* probably null Het
Slk T G 19: 47,603,862 (GRCm39) V202G probably damaging Het
Smarca2 T A 19: 26,597,277 (GRCm39) V53D possibly damaging Het
Snrnp200 T A 2: 127,080,673 (GRCm39) V2036E probably benign Het
Sox5 A G 6: 143,790,491 (GRCm39) M523T possibly damaging Het
Syt17 A G 7: 118,036,040 (GRCm39) probably null Het
Taf2 T C 15: 54,922,276 (GRCm39) D337G possibly damaging Het
Tcstv2a G T 13: 120,725,579 (GRCm39) R81L probably benign Het
Tecrl A G 5: 83,461,134 (GRCm39) Y108H probably benign Het
Tln1 A T 4: 43,551,018 (GRCm39) F409L probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Ttc23 G A 7: 67,319,904 (GRCm39) R187Q probably benign Het
Ttl T C 2: 128,923,977 (GRCm39) V230A probably benign Het
Ube2u G A 4: 100,338,843 (GRCm39) W36* probably null Het
Ube4a A T 9: 44,857,830 (GRCm39) probably benign Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Unc45a A G 7: 79,982,728 (GRCm39) I399T possibly damaging Het
Utp25 C T 1: 192,812,445 (GRCm39) R5Q possibly damaging Het
Wdr59 A C 8: 112,193,419 (GRCm39) probably null Het
Zfp24 A G 18: 24,151,172 (GRCm39) probably benign Het
Zfp777 A T 6: 48,019,041 (GRCm39) W342R probably damaging Het
Zfp979 A T 4: 147,697,913 (GRCm39) C265* probably null Het
Zzef1 T A 11: 72,804,157 (GRCm39) L2633Q probably damaging Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80,386,798 (GRCm39) missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80,385,573 (GRCm39) missense probably benign
IGL01890:Rexo1 APN 10 80,378,845 (GRCm39) missense possibly damaging 0.85
PIT4453001:Rexo1 UTSW 10 80,386,231 (GRCm39) missense probably damaging 0.97
R0044:Rexo1 UTSW 10 80,380,212 (GRCm39) missense probably benign 0.16
R0365:Rexo1 UTSW 10 80,378,410 (GRCm39) missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80,380,684 (GRCm39) missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80,380,239 (GRCm39) missense probably benign 0.04
R1146:Rexo1 UTSW 10 80,380,239 (GRCm39) missense probably benign 0.04
R1511:Rexo1 UTSW 10 80,385,884 (GRCm39) missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80,378,585 (GRCm39) missense probably benign 0.41
R1807:Rexo1 UTSW 10 80,378,413 (GRCm39) missense possibly damaging 0.95
R1868:Rexo1 UTSW 10 80,378,754 (GRCm39) missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80,386,303 (GRCm39) missense probably benign 0.00
R1936:Rexo1 UTSW 10 80,386,303 (GRCm39) missense probably benign 0.00
R1957:Rexo1 UTSW 10 80,379,200 (GRCm39) missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80,397,100 (GRCm39) missense probably benign 0.01
R2153:Rexo1 UTSW 10 80,379,943 (GRCm39) nonsense probably null
R2262:Rexo1 UTSW 10 80,385,403 (GRCm39) missense probably benign 0.02
R4472:Rexo1 UTSW 10 80,378,492 (GRCm39) missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80,382,255 (GRCm39) missense probably benign 0.01
R4972:Rexo1 UTSW 10 80,385,527 (GRCm39) missense probably damaging 0.96
R6335:Rexo1 UTSW 10 80,379,915 (GRCm39) missense probably damaging 1.00
R6505:Rexo1 UTSW 10 80,378,845 (GRCm39) missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80,379,848 (GRCm39) missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80,386,470 (GRCm39) missense possibly damaging 0.46
R7612:Rexo1 UTSW 10 80,385,497 (GRCm39) missense probably benign 0.40
R7807:Rexo1 UTSW 10 80,385,970 (GRCm39) missense probably benign 0.09
R7840:Rexo1 UTSW 10 80,386,572 (GRCm39) missense probably benign
R8779:Rexo1 UTSW 10 80,384,292 (GRCm39) missense probably benign 0.26
R8897:Rexo1 UTSW 10 80,378,437 (GRCm39) missense probably damaging 0.98
R8995:Rexo1 UTSW 10 80,386,095 (GRCm39) missense probably damaging 0.96
R9094:Rexo1 UTSW 10 80,378,854 (GRCm39) missense probably damaging 1.00
R9411:Rexo1 UTSW 10 80,397,248 (GRCm39) missense
R9438:Rexo1 UTSW 10 80,378,848 (GRCm39) missense possibly damaging 0.46
R9524:Rexo1 UTSW 10 80,386,872 (GRCm39) missense probably damaging 1.00
R9648:Rexo1 UTSW 10 80,385,540 (GRCm39) missense probably damaging 0.97
Z1177:Rexo1 UTSW 10 80,385,609 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATGCTCAGCACAGTC -3'
(R):5'- TGACTACAACACCAGGTGTG -3'

Sequencing Primer
(F):5'- ATGCTCAGCACAGTCCTTAC -3'
(R):5'- AGGTGTGTCCCGGCCTAC -3'
Posted On 2015-07-21