Incidental Mutation 'R4471:Cdh2'
ID329462
Institutional Source Beutler Lab
Gene Symbol Cdh2
Ensembl Gene ENSMUSG00000024304
Gene Namecadherin 2
SynonymsNcad, N-cadherin
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4471 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location16588877-16809246 bp(-) (GRCm38)
Type of Mutationintron (32 bp from exon)
DNA Base Change (assembly) T to C at 16774476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025166]
PDB Structure
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
N-CADHERIN, TWO-DOMAIN FRAGMENT [X-RAY DIFFRACTION]
Solution Structure of Neural Cadherin Prodomain [SOLUTION NMR]
Crystal structure of N-cadherin domains EC12 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin ectodomain [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 A78SI92M [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 with AA insertion between residues 2 and 3 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 W2F [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025166
SMART Domains Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Cadherin_pro 31 123 5.77e-34 SMART
low complexity region 129 141 N/A INTRINSIC
CA 182 265 3.37e-17 SMART
CA 289 380 2.15e-33 SMART
CA 403 496 4.38e-16 SMART
CA 519 603 2.27e-23 SMART
CA 623 708 5.54e-2 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:Cadherin_C 753 903 6.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152779
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Cdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Cdh2 APN 18 16627636 missense possibly damaging 0.69
IGL01560:Cdh2 APN 18 16650438 missense probably benign 0.01
IGL02028:Cdh2 APN 18 16650420 missense probably benign 0.07
IGL02227:Cdh2 APN 18 16629586 missense probably benign 0.01
IGL02229:Cdh2 APN 18 16624753 missense probably benign
IGL02617:Cdh2 APN 18 16627604 missense probably damaging 1.00
IGL02685:Cdh2 APN 18 16646500 missense probably damaging 1.00
IGL02724:Cdh2 APN 18 16629480 missense probably benign 0.29
R0111:Cdh2 UTSW 18 16774509 missense probably benign
R0173:Cdh2 UTSW 18 16650257 splice site probably benign
R0197:Cdh2 UTSW 18 16629576 missense probably benign
R0563:Cdh2 UTSW 18 16629681 missense possibly damaging 0.90
R0883:Cdh2 UTSW 18 16629576 missense probably benign
R1083:Cdh2 UTSW 18 16643959 missense possibly damaging 0.61
R1270:Cdh2 UTSW 18 16627557 splice site probably benign
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1510:Cdh2 UTSW 18 16648594 missense probably benign
R1875:Cdh2 UTSW 18 16624877 missense probably benign
R2122:Cdh2 UTSW 18 16774543 missense probably benign 0.01
R2194:Cdh2 UTSW 18 16640448 missense probably damaging 1.00
R2254:Cdh2 UTSW 18 16643928 critical splice donor site probably null
R4501:Cdh2 UTSW 18 16629585 missense possibly damaging 0.53
R4620:Cdh2 UTSW 18 16648608 missense probably benign
R4832:Cdh2 UTSW 18 16627697 missense probably benign 0.01
R4944:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R4958:Cdh2 UTSW 18 16627565 splice site probably null
R5160:Cdh2 UTSW 18 16629587 missense probably damaging 0.99
R5190:Cdh2 UTSW 18 16650315 missense possibly damaging 0.54
R5446:Cdh2 UTSW 18 16646627 missense probably damaging 1.00
R5552:Cdh2 UTSW 18 16640463 missense possibly damaging 0.88
R5699:Cdh2 UTSW 18 16646522 nonsense probably null
R5912:Cdh2 UTSW 18 16640450 missense possibly damaging 0.79
R5949:Cdh2 UTSW 18 16601630 missense probably damaging 1.00
R6313:Cdh2 UTSW 18 16774522 missense probably benign 0.00
R6633:Cdh2 UTSW 18 16640548 missense probably benign 0.00
R7822:Cdh2 UTSW 18 16624284 missense probably benign 0.24
R8022:Cdh2 UTSW 18 16590301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCTGTCTAAAGTTTCTCGG -3'
(R):5'- TCTTAGTAGAAGGAGGCAGCAATC -3'

Sequencing Primer
(F):5'- GTTTCTCGGTATAAACTGAACAAGG -3'
(R):5'- AATCATTGCCCACATTTTTCTCTTG -3'
Posted On2015-07-21