Incidental Mutation 'R4435:Gpn3'
ID329477
Institutional Source Beutler Lab
Gene Symbol Gpn3
Ensembl Gene ENSMUSG00000029464
Gene NameGPN-loop GTPase 3
SynonymsAtpbd1c, A930018B01Rik, D5Ertd708e
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122371876-122382902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122382052 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 223 (D223G)
Ref Sequence ENSEMBL: ENSMUSP00000031420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031420] [ENSMUST00000127608] [ENSMUST00000146698]
Predicted Effect probably benign
Transcript: ENSMUST00000031420
AA Change: D223G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031420
Gene: ENSMUSG00000029464
AA Change: D223G

DomainStartEndE-ValueType
Pfam:ATP_bind_1 8 254 5.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123537
SMART Domains Protein: ENSMUSP00000120667
Gene: ENSMUSG00000029464

DomainStartEndE-ValueType
Pfam:ATP_bind_1 1 112 2.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127608
SMART Domains Protein: ENSMUSP00000143405
Gene: ENSMUSG00000029464

DomainStartEndE-ValueType
Pfam:ATP_bind_1 8 189 1.2e-78 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146698
AA Change: M15V
Predicted Effect unknown
Transcript: ENSMUST00000151173
AA Change: D38G
SMART Domains Protein: ENSMUSP00000116560
Gene: ENSMUSG00000029464
AA Change: D38G

DomainStartEndE-ValueType
Pfam:ATP_bind_1 1 70 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196642
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Gpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Gpn3 APN 5 122381265 missense probably benign 0.02
IGL02625:Gpn3 APN 5 122381194 missense probably damaging 0.98
IGL02947:Gpn3 APN 5 122378488 missense possibly damaging 0.94
R0125:Gpn3 UTSW 5 122381418 missense probably benign 0.01
R1171:Gpn3 UTSW 5 122378520 missense probably benign 0.00
R4434:Gpn3 UTSW 5 122382052 missense probably benign 0.01
R4673:Gpn3 UTSW 5 122373918 missense probably damaging 1.00
R4687:Gpn3 UTSW 5 122378575 missense possibly damaging 0.73
R4944:Gpn3 UTSW 5 122382240 intron probably benign
R6209:Gpn3 UTSW 5 122382112 missense probably benign
R6280:Gpn3 UTSW 5 122373959 missense probably benign 0.00
R6315:Gpn3 UTSW 5 122372575 start gained probably benign
R6319:Gpn3 UTSW 5 122372575 start gained probably benign
R6323:Gpn3 UTSW 5 122372575 start gained probably benign
R6324:Gpn3 UTSW 5 122372575 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCGAGGTCAGAAAGGTCAGC -3'
(R):5'- CTGTCACAAAGGCAGCACAG -3'

Sequencing Primer
(F):5'- TGTGTGCCAGGAAGACACTCTG -3'
(R):5'- AGACCATGCATCCCCTCCTC -3'
Posted On2015-07-21