Incidental Mutation 'R4435:Olfr446'
ID329479
Institutional Source Beutler Lab
Gene Symbol Olfr446
Ensembl Gene ENSMUSG00000073111
Gene Nameolfactory receptor 446
SynonymsGA_x6K02T2P3E9-4632269-4631343, MOR261-12
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42921377-42931141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42928089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 286 (I286N)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
Predicted Effect probably damaging
Transcript: ENSMUST00000101461
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: I286N

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215369
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215686
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216199
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Olfr446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Olfr446 APN 6 42927896 missense probably benign 0.24
IGL03164:Olfr446 APN 6 42928130 nonsense probably null
PIT4519001:Olfr446 UTSW 6 42927644 missense probably damaging 1.00
R1760:Olfr446 UTSW 6 42927497 missense possibly damaging 0.90
R1883:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R1884:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R2180:Olfr446 UTSW 6 42927525 missense probably benign 0.14
R3001:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R3002:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R4544:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R4546:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R5009:Olfr446 UTSW 6 42927433 missense probably damaging 1.00
R5236:Olfr446 UTSW 6 42927781 missense probably benign 0.04
R5290:Olfr446 UTSW 6 42928038 missense probably damaging 0.98
R5297:Olfr446 UTSW 6 42927437 missense probably benign 0.17
R7371:Olfr446 UTSW 6 42927535 nonsense probably null
X0065:Olfr446 UTSW 6 42928056 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATTCTCGGAATCCACTCAGG -3'
(R):5'- GAACAGGCGTTTGAGTGTACATG -3'

Sequencing Primer
(F):5'- AATCCACTCAGGGGAGGGTC -3'
(R):5'- GTGGACCAGGCTAGCTTCAAATTC -3'
Posted On2015-07-21