Incidental Mutation 'R4435:Arhgap25'
ID329480
Institutional Source Beutler Lab
Gene Symbol Arhgap25
Ensembl Gene ENSMUSG00000030047
Gene NameRho GTPase activating protein 25
Synonyms
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87458545-87533259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87462938 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 576 (I576V)
Ref Sequence ENSEMBL: ENSMUSP00000109267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071024] [ENSMUST00000101197] [ENSMUST00000113637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071024
AA Change: I487V

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068964
Gene: ENSMUSG00000030047
AA Change: I487V

DomainStartEndE-ValueType
PDB:1V89|A 1 63 7e-33 PDB
Blast:RhoGAP 16 66 9e-22 BLAST
RhoGAP 86 262 6.28e-64 SMART
coiled coil region 454 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101197
AA Change: I550V

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098758
Gene: ENSMUSG00000030047
AA Change: I550V

DomainStartEndE-ValueType
PH 21 127 2.11e-21 SMART
RhoGAP 149 325 6.28e-64 SMART
coiled coil region 517 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113637
AA Change: I576V

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109267
Gene: ENSMUSG00000030047
AA Change: I576V

DomainStartEndE-ValueType
PH 47 153 2.11e-21 SMART
RhoGAP 175 351 6.28e-64 SMART
coiled coil region 543 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203559
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAPs, such as ARHGAP25, encode negative regulators of Rho GTPases (see ARHA; MIM 165390), which are implicated in actin remodeling, cell polarity, and cell migration (Katoh and Katoh, 2004 [PubMed 15254788]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukocyte transendothelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Arhgap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Arhgap25 APN 6 87496076 missense possibly damaging 0.92
IGL02112:Arhgap25 APN 6 87467937 missense possibly damaging 0.80
IGL03051:Arhgap25 APN 6 87495914 missense probably null 1.00
R0462:Arhgap25 UTSW 6 87459960 missense possibly damaging 0.88
R1636:Arhgap25 UTSW 6 87495941 missense probably damaging 1.00
R1777:Arhgap25 UTSW 6 87463307 missense probably benign 0.41
R2077:Arhgap25 UTSW 6 87460008 missense probably damaging 1.00
R2845:Arhgap25 UTSW 6 87459967 missense possibly damaging 0.86
R4091:Arhgap25 UTSW 6 87463035 missense probably benign
R4773:Arhgap25 UTSW 6 87496071 missense probably benign
R5121:Arhgap25 UTSW 6 87532864 missense probably benign 0.01
R5169:Arhgap25 UTSW 6 87463270 missense possibly damaging 0.93
R5334:Arhgap25 UTSW 6 87463261 missense possibly damaging 0.77
R5726:Arhgap25 UTSW 6 87463459 missense probably benign
R6696:Arhgap25 UTSW 6 87465651 missense probably damaging 1.00
R6696:Arhgap25 UTSW 6 87466563 missense probably damaging 0.99
R7947:Arhgap25 UTSW 6 87463087 missense probably benign 0.32
R8113:Arhgap25 UTSW 6 87488305 nonsense probably null
Z1176:Arhgap25 UTSW 6 87476186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTCATCGGAAGTGTAAG -3'
(R):5'- ACCAGCGGACTTCTACCTAC -3'

Sequencing Primer
(F):5'- CCTCATCGGAAGTGTAAGGATTCTC -3'
(R):5'- GCGGACTTCTACCTACGATAATG -3'
Posted On2015-07-21