Incidental Mutation 'R4435:Nwd1'
ID329485
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72688136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 934 (V934A)
Ref Sequence ENSEMBL: ENSMUSP00000154488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably benign
Transcript: ENSMUST00000093427
AA Change: V893A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: V893A

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably benign
Transcript: ENSMUST00000161254
AA Change: V893A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: V893A

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175535
Predicted Effect possibly damaging
Transcript: ENSMUST00000228312
AA Change: V934A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTGCGGTCCTTCCTTCTAAAG -3'
(R):5'- GAGGTGAATTGTTATATAGTTCTGACC -3'

Sequencing Primer
(F):5'- TGTGACTTCAGGATGACCAC -3'
(R):5'- TAGTTCTGACCAATGCAGAGC -3'
Posted On2015-07-21