Mutagenetix > Incidental Mutations

Incidental Mutation 'R4435:Nwd1'

329485

Institutional Source

Beutler Lab

Gene Symbol

Nwd1

Ensembl Gene

ENSMUSG00000048148

Gene Name

NACHT and WD repeat domain containing 1

Synonyms

A230063L24Rik

MMRRC Submission

041149-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R4435 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72646711-72717876 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72688136 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 934 (V934A)

Ref Sequence

ENSEMBL: ENSMUSP00000154488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]

Predicted Effect

probably benign
Transcript: ENSMUST00000093427
AA Change: V893A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: V893A

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
Pfam:AAA_16	312	457	7.3e-8	PFAM
Pfam:NACHT	336	511	1.3e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	2e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	4e-10	BLAST
WD40	1118	1156	5.97e-1	SMART
WD40	1160	1198	6.6e1	SMART
WD40	1245	1283	5.3e1	SMART
WD40	1286	1326	2.13e1	SMART
WD40	1340	1375	1.06e2	SMART
WD40	1377	1416	3.5e-4	SMART
WD40	1421	1461	2.66e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160443

SMART Domains

Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160912

Predicted Effect

probably benign
Transcript: ENSMUST00000161254
AA Change: V893A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: V893A

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
Pfam:NACHT	336	511	2.1e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	1e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	3e-10	BLAST
WD40	1118	1156	2.49e-1	SMART
WD40	1203	1241	5.3e1	SMART
WD40	1244	1284	2.13e1	SMART
WD40	1298	1333	1.06e2	SMART
WD40	1335	1374	3.5e-4	SMART
WD40	1379	1419	2.66e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161386

SMART Domains

Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
Pfam:NACHT	336	511	1.2e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	984	1e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161557

SMART Domains

Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162248

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163026

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175535

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228312
AA Change: V934A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	C	12: 113,490,661	Q366P	probably damaging	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Ank3	C	T	10: 69,987,070	S523L	probably damaging	Het
Arap1	C	A	7: 101,390,254	R574S	possibly damaging	Het
Arhgap25	T	C	6: 87,462,938	I576V	possibly damaging	Het
Ascc3	T	A	10: 50,721,885	V1283D	probably benign	Het
Asnsd1	A	T	1: 53,348,073		probably null	Het
Asrgl1	C	T	19: 9,119,199	V125I	probably damaging	Het
Bccip	A	G	7: 133,719,213	R239G	probably benign	Het
Cdyl	T	C	13: 35,858,250		probably null	Het
Cyfip1	T	C	7: 55,900,041	I650T	probably damaging	Het
Dennd4c	C	A	4: 86,798,075	Q506K	probably benign	Het
Fam135b	T	C	15: 71,448,739	D1313G	probably damaging	Het
Fam169a	A	G	13: 97,126,740	D567G	probably damaging	Het
Gm5134	T	G	10: 75,995,824	S366A	probably damaging	Het
Gm5849	T	A	3: 90,777,875	K1M	probably null	Het
Gpn3	A	G	5: 122,382,052	D223G	probably benign	Het
Hk1	A	G	10: 62,275,844	Y713H	probably damaging	Het
Ifih1	A	G	2: 62,645,890	L14P	probably damaging	Het
Kmt2c	A	T	5: 25,314,877	N2078K	possibly damaging	Het
Maf	T	A	8: 115,706,853	E4V	unknown	Het
Mbtd1	T	A	11: 93,932,222	D489E	probably benign	Het
Myrip	C	T	9: 120,335,614		probably benign	Het
Nedd4l	A	G	18: 65,212,825	D816G	possibly damaging	Het
Olfr290	A	G	7: 84,916,021	M81V	probably benign	Het
Olfr446	T	A	6: 42,928,089	I286N	probably damaging	Het
Psd	A	T	19: 46,314,494	I158N	probably damaging	Het
Ptprq	A	G	10: 107,685,055	V752A	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Senp2	T	A	16: 22,014,241	V93E	possibly damaging	Het
Siah1b	G	A	X: 164,071,692	P131S	probably damaging	Het
Slc38a4	T	C	15: 97,009,018	S280G	probably benign	Het
Sos2	T	C	12: 69,614,699	E666G	possibly damaging	Het
Strip2	T	C	6: 29,925,050	V129A	probably benign	Het
Tsc2	G	A	17: 24,599,713	P1450L	probably benign	Het
Ttn	T	C	2: 76,916,875	E4610G	probably benign	Het
Uimc1	T	C	13: 55,075,823	E212G	probably damaging	Het
Zc3h18	T	C	8: 122,413,952		probably null	Het
Zswim3	T	A	2: 164,820,643	C348S	probably benign	Het

Other mutations in Nwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Nwd1	APN	8	72671077	missense	probably damaging	0.99
IGL01294:Nwd1	APN	8	72711745	missense	probably damaging	1.00
IGL01298:Nwd1	APN	8	72662331	missense	probably benign	0.00
IGL01333:Nwd1	APN	8	72666811	missense	possibly damaging	0.90
IGL01371:Nwd1	APN	8	72675115	missense	probably damaging	1.00
IGL02244:Nwd1	APN	8	72707582	missense	probably damaging	1.00
IGL02579:Nwd1	APN	8	72707527	missense	probably damaging	1.00
IGL02608:Nwd1	APN	8	72667375	missense	probably damaging	1.00
IGL02632:Nwd1	APN	8	72667454	missense	possibly damaging	0.80
IGL02893:Nwd1	APN	8	72667501	missense	probably damaging	1.00
IGL03010:Nwd1	APN	8	72688060	splice site	probably benign
R0017:Nwd1	UTSW	8	72709425	splice site	probably benign
R0066:Nwd1	UTSW	8	72711856	missense	probably benign	0.27
R0066:Nwd1	UTSW	8	72711856	missense	probably benign	0.27
R0505:Nwd1	UTSW	8	72662337	missense	probably damaging	0.96
R0511:Nwd1	UTSW	8	72682005	missense	probably damaging	1.00
R0612:Nwd1	UTSW	8	72667680	missense	probably damaging	0.99
R0681:Nwd1	UTSW	8	72662337	missense	probably damaging	0.96
R0763:Nwd1	UTSW	8	72671044	missense	probably damaging	1.00
R0905:Nwd1	UTSW	8	72709449	missense	probably damaging	0.99
R1136:Nwd1	UTSW	8	72697769	splice site	probably benign
R1483:Nwd1	UTSW	8	72657086	missense	probably damaging	0.96
R1630:Nwd1	UTSW	8	72667029	missense	possibly damaging	0.66
R1724:Nwd1	UTSW	8	72711620	missense	probably damaging	1.00
R1732:Nwd1	UTSW	8	72666835	missense	possibly damaging	0.96
R1885:Nwd1	UTSW	8	72704994	missense	probably benign	0.00
R1973:Nwd1	UTSW	8	72704962	missense	possibly damaging	0.46
R2393:Nwd1	UTSW	8	72662427	missense	probably benign
R2926:Nwd1	UTSW	8	72667012	missense	probably damaging	1.00
R3706:Nwd1	UTSW	8	72667116	missense	possibly damaging	0.66
R3916:Nwd1	UTSW	8	72667811	nonsense	probably null
R3917:Nwd1	UTSW	8	72667811	nonsense	probably null
R4153:Nwd1	UTSW	8	72681936	missense	probably damaging	1.00
R4426:Nwd1	UTSW	8	72666795	missense	probably damaging	1.00
R4522:Nwd1	UTSW	8	72670951	missense	probably damaging	1.00
R4622:Nwd1	UTSW	8	72667300	missense	probably damaging	1.00
R4659:Nwd1	UTSW	8	72695321	missense	probably benign	0.03
R4694:Nwd1	UTSW	8	72667330	missense	probably damaging	1.00
R4837:Nwd1	UTSW	8	72657131	missense	probably damaging	1.00
R4844:Nwd1	UTSW	8	72667114	missense	probably damaging	1.00
R4906:Nwd1	UTSW	8	72672213	missense	probably damaging	1.00
R5041:Nwd1	UTSW	8	72705055	missense	possibly damaging	0.90
R5183:Nwd1	UTSW	8	72671086	missense	probably benign	0.07
R5416:Nwd1	UTSW	8	72666694	missense	possibly damaging	0.90
R5553:Nwd1	UTSW	8	72704976	missense	possibly damaging	0.83
R5670:Nwd1	UTSW	8	72693117	missense	probably damaging	0.97
R5699:Nwd1	UTSW	8	72702974	critical splice donor site	probably null
R5722:Nwd1	UTSW	8	72675244	missense	probably damaging	0.97
R5762:Nwd1	UTSW	8	72670914	missense	probably damaging	1.00
R5778:Nwd1	UTSW	8	72693117	missense	probably damaging	0.97
R5992:Nwd1	UTSW	8	72653573	critical splice donor site	probably null
R6163:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6164:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6165:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6212:Nwd1	UTSW	8	72695322	missense	possibly damaging	0.95
R6443:Nwd1	UTSW	8	72662366	missense	possibly damaging	0.58
R6865:Nwd1	UTSW	8	72657062	missense	possibly damaging	0.63
R6928:Nwd1	UTSW	8	72682025	missense	probably benign	0.27
R6944:Nwd1	UTSW	8	72653534	missense	possibly damaging	0.69
R6979:Nwd1	UTSW	8	72667660	missense	probably damaging	1.00
R7060:Nwd1	UTSW	8	72666694	missense	probably damaging	1.00
R7102:Nwd1	UTSW	8	72695329	missense	probably damaging	1.00
R7265:Nwd1	UTSW	8	72692928	missense	probably benign	0.29
R7343:Nwd1	UTSW	8	72711782	missense	probably damaging	0.98
R7391:Nwd1	UTSW	8	72662418	missense	probably damaging	0.99
R7424:Nwd1	UTSW	8	72675173	missense	possibly damaging	0.86
R7438:Nwd1	UTSW	8	72707830	missense	probably benign	0.00
R7502:Nwd1	UTSW	8	72707393	missense	probably damaging	0.98
X0067:Nwd1	UTSW	8	72667256	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GTGCGGTCCTTCCTTCTAAAG -3'
(R):5'- GAGGTGAATTGTTATATAGTTCTGACC -3'

Sequencing Primer
(F):5'- TGTGACTTCAGGATGACCAC -3'
(R):5'- TAGTTCTGACCAATGCAGAGC -3'

Posted On

2015-07-21