Incidental Mutation 'R4435:Maf'
ID329486
Institutional Source Beutler Lab
Gene Symbol Maf
Ensembl Gene ENSMUSG00000055435
Gene Nameavian musculoaponeurotic fibrosarcoma oncogene homolog
SynonymsA230108G15Rik, c-maf, 2810401A20Rik
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R4435 (G1)
Quality Score190
Status Not validated
Chromosome8
Chromosomal Location115682942-115707794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115706853 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 4 (E4V)
Ref Sequence ENSEMBL: ENSMUSP00000104732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069009] [ENSMUST00000109104]
Predicted Effect unknown
Transcript: ENSMUST00000069009
AA Change: E4V
SMART Domains Protein: ENSMUSP00000067704
Gene: ENSMUSG00000055435
AA Change: E4V

DomainStartEndE-ValueType
low complexity region 54 82 N/A INTRINSIC
Pfam:Maf_N 86 119 6.7e-23 PFAM
low complexity region 134 154 N/A INTRINSIC
low complexity region 160 253 N/A INTRINSIC
BRLZ 281 347 8.4e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109104
AA Change: E4V
SMART Domains Protein: ENSMUSP00000104732
Gene: ENSMUSG00000055435
AA Change: E4V

DomainStartEndE-ValueType
low complexity region 54 82 N/A INTRINSIC
Pfam:Maf_N 86 120 9.3e-24 PFAM
low complexity region 134 154 N/A INTRINSIC
low complexity region 160 253 N/A INTRINSIC
BRLZ 281 347 8.4e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134649
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes show increased mortality at embryonic day 17.5-18.5, low postnatal survival, abnormal differentiation of lens fiber cells causing microphthalmia, defective lens development and impaired IL4 production by CD4+ T cells and natural killer cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Maf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Maf APN 8 115705963 missense probably damaging 1.00
R0279:Maf UTSW 8 115705756 missense possibly damaging 0.65
R1529:Maf UTSW 8 115693170 missense probably benign 0.00
R4177:Maf UTSW 8 115706471 nonsense probably null
R4941:Maf UTSW 8 115706793 missense unknown
R5855:Maf UTSW 8 115705792 missense probably benign 0.28
R6718:Maf UTSW 8 115706800 missense unknown
R7499:Maf UTSW 8 115693181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTAGTAGTCTTCCAGGTGCGC -3'
(R):5'- GTGTGCACGTTCGAGCTTTC -3'

Sequencing Primer
(F):5'- CAGGTGCGCCTTCTGTTCG -3'
(R):5'- TTCGAGCTTTCGGGCCAC -3'
Posted On2015-07-21