Incidental Mutation 'R4435:Zc3h18'
ID329487
Institutional Source Beutler Lab
Gene Symbol Zc3h18
Ensembl Gene ENSMUSG00000017478
Gene Namezinc finger CCCH-type containing 18
Synonyms
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4435 (G1)
Quality Score222
Status Not validated
Chromosome8
Chromosomal Location122376609-122417360 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 122413952 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017622] [ENSMUST00000093073] [ENSMUST00000127664] [ENSMUST00000176629]
Predicted Effect probably null
Transcript: ENSMUST00000017622
SMART Domains Protein: ENSMUSP00000017622
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 3e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 705 748 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
low complexity region 794 828 N/A INTRINSIC
low complexity region 871 887 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
coiled coil region 940 968 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093073
SMART Domains Protein: ENSMUSP00000090761
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
ZnF_C3H1 215 240 2.57e-3 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 285 292 N/A INTRINSIC
coiled coil region 394 460 N/A INTRINSIC
low complexity region 528 616 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
low complexity region 665 679 N/A INTRINSIC
low complexity region 681 724 N/A INTRINSIC
low complexity region 732 746 N/A INTRINSIC
low complexity region 770 804 N/A INTRINSIC
low complexity region 847 863 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
coiled coil region 916 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175819
SMART Domains Protein: ENSMUSP00000135055
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 3 34 N/A INTRINSIC
low complexity region 67 133 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176629
SMART Domains Protein: ENSMUSP00000134743
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 6e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 772 806 N/A INTRINSIC
low complexity region 849 865 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
coiled coil region 918 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177049
SMART Domains Protein: ENSMUSP00000135014
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 39 82 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 128 162 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177049
SMART Domains Protein: ENSMUSP00000135014
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 39 82 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 128 162 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177123
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Zc3h18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Zc3h18 APN 8 122386852 unclassified probably benign
IGL01160:Zc3h18 APN 8 122408250 unclassified probably benign
IGL01472:Zc3h18 APN 8 122416657 unclassified probably benign
R1525:Zc3h18 UTSW 8 122413938 missense probably benign 0.34
R1996:Zc3h18 UTSW 8 122407387 unclassified probably benign
R2351:Zc3h18 UTSW 8 122403187 nonsense probably null
R2398:Zc3h18 UTSW 8 122413866 intron probably benign
R2516:Zc3h18 UTSW 8 122403165 intron probably benign
R4734:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4749:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4885:Zc3h18 UTSW 8 122401706 intron probably benign
R4952:Zc3h18 UTSW 8 122410900 unclassified probably benign
R5001:Zc3h18 UTSW 8 122383520 missense probably damaging 1.00
R5098:Zc3h18 UTSW 8 122386869 missense probably damaging 1.00
R5172:Zc3h18 UTSW 8 122407420 unclassified probably benign
R5213:Zc3h18 UTSW 8 122383649 missense probably damaging 1.00
R5337:Zc3h18 UTSW 8 122386902 missense probably damaging 1.00
R5558:Zc3h18 UTSW 8 122386920 missense probably damaging 1.00
R5611:Zc3h18 UTSW 8 122408370 critical splice donor site probably null
R6080:Zc3h18 UTSW 8 122416544 unclassified probably benign
R6315:Zc3h18 UTSW 8 122383865 missense probably benign 0.28
R6349:Zc3h18 UTSW 8 122408286 unclassified probably benign
R7371:Zc3h18 UTSW 8 122413021 missense unknown
R7513:Zc3h18 UTSW 8 122408254 missense unknown
R7674:Zc3h18 UTSW 8 122383556 frame shift probably null
R7684:Zc3h18 UTSW 8 122407426 missense unknown
R7685:Zc3h18 UTSW 8 122413876 missense unknown
R7686:Zc3h18 UTSW 8 122413876 missense unknown
R7849:Zc3h18 UTSW 8 122383971 missense probably damaging 1.00
V1024:Zc3h18 UTSW 8 122383857 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGAGCAAAGAACCACTC -3'
(R):5'- ATCTTGTGCGCTACCACTGAG -3'

Sequencing Primer
(F):5'- GGGAGCAAAGAACCACTCTCCAG -3'
(R):5'- TAATCCCAGCACTTTGGAGG -3'
Posted On2015-07-21