Incidental Mutation 'R4435:Hk1'
ID329491
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Namehexokinase 1
SynonymsmHk1-s, Hk-1, Hk1-s
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62268855-62379908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62275844 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 713 (Y713H)
Ref Sequence ENSEMBL: ENSMUSP00000111946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422]
Predicted Effect probably damaging
Transcript: ENSMUST00000072357
AA Change: Y713H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: Y713H

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099691
AA Change: Y686H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: Y686H

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116238
AA Change: Y713H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: Y713H

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130422
AA Change: Y685H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: Y685H

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62286348 nonsense probably null
IGL01108:Hk1 APN 10 62296708 missense probably benign 0.00
IGL01810:Hk1 APN 10 62353105 missense probably benign 0.13
IGL01950:Hk1 APN 10 62315394 missense probably damaging 0.99
IGL02165:Hk1 APN 10 62281888 missense probably damaging 1.00
IGL02227:Hk1 APN 10 62281140 splice site probably benign
IGL02257:Hk1 APN 10 62271643 missense probably benign 0.07
IGL02341:Hk1 APN 10 62284380 missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62295773 missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62292359 missense probably benign 0.21
IGL02700:Hk1 APN 10 62284811 missense probably damaging 1.00
IGL02863:Hk1 APN 10 62295755 missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62271799 missense probably damaging 1.00
BB009:Hk1 UTSW 10 62315520 missense probably damaging 1.00
BB019:Hk1 UTSW 10 62315520 missense probably damaging 1.00
R0029:Hk1 UTSW 10 62315394 missense probably damaging 0.99
R0436:Hk1 UTSW 10 62299275 splice site probably benign
R0853:Hk1 UTSW 10 62271716 nonsense probably null
R1422:Hk1 UTSW 10 62296094 missense probably null 0.98
R1531:Hk1 UTSW 10 62284784 missense probably damaging 1.00
R1760:Hk1 UTSW 10 62281899 missense probably damaging 1.00
R2064:Hk1 UTSW 10 62286536 missense probably benign 0.03
R3236:Hk1 UTSW 10 62296019 splice site probably null
R3788:Hk1 UTSW 10 62275688 missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62290319 missense probably benign 0.10
R4373:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4374:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4377:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4609:Hk1 UTSW 10 62358415 utr 5 prime probably benign
R4648:Hk1 UTSW 10 62304779 missense probably benign 0.00
R4864:Hk1 UTSW 10 62342539 missense probably benign 0.00
R4934:Hk1 UTSW 10 62358386 utr 5 prime probably benign
R5110:Hk1 UTSW 10 62286651 missense probably damaging 1.00
R5352:Hk1 UTSW 10 62304770 missense probably damaging 0.97
R5569:Hk1 UTSW 10 62286441 missense probably benign 0.35
R5609:Hk1 UTSW 10 62342551 missense probably benign 0.30
R5647:Hk1 UTSW 10 62275744 missense probably damaging 0.99
R5750:Hk1 UTSW 10 62274466 missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62286449 missense probably benign
R5832:Hk1 UTSW 10 62292365 missense probably benign 0.17
R5905:Hk1 UTSW 10 62353058 missense probably null 0.82
R5933:Hk1 UTSW 10 62269994 missense probably damaging 1.00
R6028:Hk1 UTSW 10 62353058 missense probably null 0.82
R6196:Hk1 UTSW 10 62299259 missense probably damaging 1.00
R6314:Hk1 UTSW 10 62292444 missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62291978 missense probably benign
R6801:Hk1 UTSW 10 62281131 missense probably damaging 0.97
R6838:Hk1 UTSW 10 62271658 missense probably damaging 0.98
R7045:Hk1 UTSW 10 62286570 missense probably damaging 1.00
R7420:Hk1 UTSW 10 62269982 missense probably damaging 1.00
R7491:Hk1 UTSW 10 62295745 missense probably damaging 1.00
R7527:Hk1 UTSW 10 62304782 missense probably damaging 0.99
R7561:Hk1 UTSW 10 62281028 splice site probably null
R7932:Hk1 UTSW 10 62315520 missense probably damaging 1.00
R8031:Hk1 UTSW 10 62296699 missense probably benign 0.15
R8128:Hk1 UTSW 10 62281843 missense probably benign
R8204:Hk1 UTSW 10 62296744 missense probably damaging 1.00
R8294:Hk1 UTSW 10 62295845 missense probably benign 0.00
X0018:Hk1 UTSW 10 62275706 missense probably benign 0.02
X0063:Hk1 UTSW 10 62275704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAGCCATAGAATCCAG -3'
(R):5'- TCAGAGCTCCCGGTGTGAAG -3'

Sequencing Primer
(F):5'- ACCCAACAGGCTGATTACCTTTG -3'
(R):5'- CCCGGTGTGAAGCCCCC -3'
Posted On2015-07-21