Incidental Mutation 'R4435:Cdyl'
ID329497
Institutional Source Beutler Lab
Gene Symbol Cdyl
Ensembl Gene ENSMUSG00000059288
Gene Namechromodomain protein, Y chromosome-like
Synonyms
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location35659833-35874063 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35858250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075220] [ENSMUST00000163595]
Predicted Effect probably null
Transcript: ENSMUST00000075220
SMART Domains Protein: ENSMUSP00000074707
Gene: ENSMUSG00000059288

DomainStartEndE-ValueType
CHROMO 55 109 2.06e-18 SMART
low complexity region 116 129 N/A INTRINSIC
Pfam:ECH_1 342 593 1.8e-35 PFAM
Pfam:ECH_2 348 592 6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163595
SMART Domains Protein: ENSMUSP00000131784
Gene: ENSMUSG00000059288

DomainStartEndE-ValueType
CHROMO 6 60 1.58e-19 SMART
low complexity region 67 80 N/A INTRINSIC
Pfam:ECH 291 539 4e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional homozygous knockout in the cerebral cortex affects neuronal migration and results in increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nedd4l A G 18: 65,212,825 D816G possibly damaging Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Cdyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cdyl APN 13 35816113 missense probably damaging 0.98
IGL01547:Cdyl APN 13 35790162 missense possibly damaging 0.90
IGL01911:Cdyl APN 13 35863243 missense probably damaging 0.97
IGL02584:Cdyl APN 13 35683786 missense probably benign
IGL02754:Cdyl APN 13 35683742 splice site probably benign
R1630:Cdyl UTSW 13 35683803 missense possibly damaging 0.66
R1678:Cdyl UTSW 13 35856889 missense probably damaging 0.99
R1802:Cdyl UTSW 13 35872636 nonsense probably null
R5841:Cdyl UTSW 13 35872561 missense probably damaging 1.00
R5860:Cdyl UTSW 13 35858083 missense possibly damaging 0.73
R6430:Cdyl UTSW 13 35871606 missense possibly damaging 0.74
R7127:Cdyl UTSW 13 35856668 missense probably benign 0.01
R7296:Cdyl UTSW 13 35863395 missense probably damaging 1.00
R7369:Cdyl UTSW 13 35816009 missense probably damaging 1.00
R7422:Cdyl UTSW 13 35858194 missense possibly damaging 0.90
R7635:Cdyl UTSW 13 35871651 missense probably damaging 1.00
R7756:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7758:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7764:Cdyl UTSW 13 35816143 missense possibly damaging 0.92
R8221:Cdyl UTSW 13 35816164 missense probably benign 0.00
Z1176:Cdyl UTSW 13 35815966 missense probably damaging 1.00
Z1177:Cdyl UTSW 13 35816070 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CAAAGTGCTCTTGACCGCTTG -3'
(R):5'- AGCTTAAGCCATCCCTGAATTC -3'

Sequencing Primer
(F):5'- ACCTGTGGTGACTTCCAGG -3'
(R):5'- CCCTGAATTCTGTGATAGATGCAAGG -3'
Posted On2015-07-21