Mutagenetix > Incidental Mutation

Incidental Mutation 'R0047:Arhgap35'

32950

Institutional Source

Beutler Lab

Gene Symbol

Arhgap35

Ensembl Gene

ENSMUSG00000058230

Gene Name

Rho GTPase activating protein 35

Synonyms

p190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik

MMRRC Submission

038341-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0047 (G1)

Quality Score

116

Status

Validated (trace)

Chromosome

Chromosomal Location

16493719-16614993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16561992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1049 (H1049Q)

Ref Sequence

ENSEMBL: ENSMUSP00000127379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]

AlphaFold

Q91YM2

Predicted Effect

probably benign
Transcript: ENSMUST00000075845
AA Change: H1049Q

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: H1049Q

Domain	Start	End	E-Value	Type
Pfam:Ras	154	249	6.1e-7	PFAM
FF	270	327	5.76e-9	SMART
FF	369	422	1.1e-5	SMART
FF	429	483	7.43e-12	SMART
FF	485	539	2.02e-4	SMART
Blast:RhoGAP	733	796	1e-7	BLAST
low complexity region	1037	1048	N/A	INTRINSIC
low complexity region	1214	1225	N/A	INTRINSIC
low complexity region	1227	1235	N/A	INTRINSIC
RhoGAP	1259	1433	8.14e-72	SMART
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1462	1494	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171937
AA Change: H1049Q

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: H1049Q

Domain	Start	End	E-Value	Type
Pfam:Ras	154	249	6e-7	PFAM
FF	270	327	5.76e-9	SMART
FF	369	422	1.1e-5	SMART
FF	429	483	7.43e-12	SMART
FF	485	539	2.02e-4	SMART
Blast:RhoGAP	733	796	1e-7	BLAST
low complexity region	1037	1048	N/A	INTRINSIC
low complexity region	1214	1225	N/A	INTRINSIC
low complexity region	1227	1235	N/A	INTRINSIC
RhoGAP	1259	1433	8.14e-72	SMART
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1462	1494	N/A	INTRINSIC

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,264	T405A	probably damaging	Het
4932438A13Rik	T	A	3: 36,908,192	L481M	possibly damaging	Het
Acer1	A	T	17: 56,955,624	D175E	possibly damaging	Het
Acsf2	T	C	11: 94,569,342	I395V	probably benign	Het
Adamts9	G	A	6: 92,905,306		probably benign	Het
Amigo3	T	C	9: 108,054,658	S427P	probably benign	Het
Ankrd35	A	G	3: 96,684,063	K555R	probably benign	Het
Arhgef5	G	A	6: 43,265,621		probably null	Het
Arid4a	T	G	12: 71,075,419	L858W	probably damaging	Het
Bbox1	A	G	2: 110,268,302	F310S	probably damaging	Het
Bhlhe22	T	C	3: 18,055,569	L261P	probably damaging	Het
Bmper	T	A	9: 23,406,686	C534S	probably damaging	Het
Cacna1d	T	G	14: 30,346,790		probably benign	Het
Camk2g	G	A	14: 20,771,068		probably benign	Het
Capn12	G	A	7: 28,890,387		probably null	Het
Cdkl4	T	G	17: 80,550,845	N115T	probably benign	Het
Chchd1	T	C	14: 20,704,163	S48P	possibly damaging	Het
Chia1	G	T	3: 106,115,257	C49F	probably damaging	Het
Cnot7	A	G	8: 40,495,921		probably benign	Het
Crh	T	C	3: 19,694,037	E147G	probably damaging	Het
Cux1	T	C	5: 136,363,253		probably benign	Het
Cyp2b19	T	A	7: 26,766,826	D351E	probably benign	Het
Dctn1	G	T	6: 83,182,632	G31*	probably null	Het
Duox1	T	A	2: 122,346,641		probably benign	Het
Egflam	T	G	15: 7,253,430	E382A	possibly damaging	Het
Ext1	T	C	15: 53,345,146	N73S	probably benign	Het
Ffar4	A	G	19: 38,114,004		probably benign	Het
Glg1	A	T	8: 111,165,582	M866K	probably damaging	Het
Golm1	T	A	13: 59,645,100	H197L	probably benign	Het
Gtse1	A	G	15: 85,862,378	K132E	probably damaging	Het
Gxylt2	A	T	6: 100,733,378		probably benign	Het
Hrc	T	A	7: 45,336,689	S421R	probably benign	Het
Ighg2c	T	A	12: 113,288,168		probably benign	Het
Ihh	A	G	1: 74,946,591	I245T	probably benign	Het
Ilf3	T	A	9: 21,388,714	M65K	possibly damaging	Het
Insr	A	G	8: 3,202,947	V404A	probably damaging	Het
Irak2	G	A	6: 113,678,738	V367I	probably benign	Het
Irak2	G	T	6: 113,672,953		probably benign	Het
Kat7	A	C	11: 95,300,208	N119K	probably benign	Het
Kif9	A	G	9: 110,485,038	I33V	probably benign	Het
Klf17	A	G	4: 117,761,032	Y43H	probably benign	Het
Kng2	T	A	16: 22,987,563	T629S	possibly damaging	Het
Lama1	A	T	17: 67,795,186		probably benign	Het
Lamb1	T	C	12: 31,278,601	I188T	possibly damaging	Het
Lpp	T	A	16: 24,661,800		probably benign	Het
Lrp12	T	C	15: 39,878,239	E360G	probably damaging	Het
Mark2	A	C	19: 7,283,577		probably benign	Het
Mmp3	T	C	9: 7,451,910		probably benign	Het
Mthfd1l	T	A	10: 3,978,727		probably benign	Het
Mtr	A	T	13: 12,222,226	S569T	probably damaging	Het
Myh13	T	A	11: 67,367,237	S1752T	probably benign	Het
Myo5a	T	A	9: 75,156,207	L565H	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nfkb1	A	T	3: 135,595,053	L72*	probably null	Het
Numa1	A	G	7: 102,009,453	K296E	probably damaging	Het
Olfr1477	A	G	19: 13,502,589	E82G	probably benign	Het
Olfr186	T	A	16: 59,027,224	M228L	probably benign	Het
Olfr201	C	T	16: 59,269,211	G152D	probably damaging	Het
Olfr508	A	G	7: 108,630,552	I187V	probably benign	Het
Olfr613	A	T	7: 103,552,322	Y179F	probably damaging	Het
Pcdhb5	A	T	18: 37,321,268	I234F	possibly damaging	Het
Pgm5	T	A	19: 24,684,556	I545F	probably damaging	Het
Pla2g2c	T	C	4: 138,743,590		probably benign	Het
Pnpla7	A	T	2: 25,011,606	E548V	probably damaging	Het
Ppm1m	C	A	9: 106,196,696	E273*	probably null	Het
Ppp2r1b	C	T	9: 50,861,573	R117*	probably null	Het
Rabgap1l	G	A	1: 160,231,789		probably benign	Het
Rapgef6	T	A	11: 54,546,378	M49K	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rnf219	T	A	14: 104,503,344		probably null	Het
Rtel1	T	G	2: 181,323,405	I146M	probably damaging	Het
Sdr9c7	A	T	10: 127,903,672	M219L	probably benign	Het
Serpina3g	T	A	12: 104,240,284	S115T	possibly damaging	Het
Serpinb1a	A	T	13: 32,850,276	L44Q	probably damaging	Het
Slc13a4	A	G	6: 35,287,362	I190T	possibly damaging	Het
Slc46a2	A	G	4: 59,914,392	L177P	probably damaging	Het
Slc47a2	C	T	11: 61,336,242	V167M	possibly damaging	Het
Snrnp200	C	T	2: 127,234,954		probably benign	Het
Snx13	C	A	12: 35,101,124		probably benign	Het
Snx25	C	T	8: 46,041,365	A828T	probably damaging	Het
Spic	A	G	10: 88,675,941	L151P	probably damaging	Het
Ssu2	G	A	6: 112,374,820	H315Y	probably damaging	Het
Stk32a	T	C	18: 43,313,378		probably benign	Het
Tbx3	A	T	5: 119,680,446	E382V	probably damaging	Het
Tcaf2	A	G	6: 42,629,613	I469T	probably benign	Het
Tln2	A	G	9: 67,240,672		probably benign	Het
Top2a	T	A	11: 98,997,856	I1260L	probably benign	Het
Treml1	C	A	17: 48,364,980	S91*	probably null	Het
Trim26	T	C	17: 36,857,864		probably benign	Het
Trmt11	T	C	10: 30,535,243	N418S	probably benign	Het
Ttf1	A	G	2: 29,084,655	Y801C	probably damaging	Het
Usp34	C	T	11: 23,464,403	A2782V	probably benign	Het
Vmn2r77	T	C	7: 86,811,650	V728A	probably benign	Het
Vps4a	T	C	8: 107,036,701	L29P	probably damaging	Het
Wdfy3	A	G	5: 101,944,033	I480T	probably damaging	Het
Wdr41	A	G	13: 95,010,287	I197V	probably damaging	Het
Ywhag	A	T	5: 135,911,299	V147E	probably damaging	Het
Zan	A	G	5: 137,403,656	M4058T	unknown	Het
Zfp236	C	T	18: 82,680,692	C88Y	probably damaging	Het

Other mutations in Arhgap35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Arhgap35	APN	7	16564415	missense	probably benign	0.03
IGL00684:Arhgap35	APN	7	16561700	missense	possibly damaging	0.93
IGL01385:Arhgap35	APN	7	16564474	missense	probably damaging	0.96
IGL01411:Arhgap35	APN	7	16564267	missense	probably benign
IGL01922:Arhgap35	APN	7	16564255	missense	possibly damaging	0.73
IGL01977:Arhgap35	APN	7	16563203	missense	probably damaging	1.00
IGL02074:Arhgap35	APN	7	16563055	missense	probably benign	0.19
IGL02305:Arhgap35	APN	7	16563665	missense	probably benign	0.15
IGL02342:Arhgap35	APN	7	16562380	missense	probably benign	0.12
IGL02973:Arhgap35	APN	7	16562878	missense	possibly damaging	0.50
IGL02989:Arhgap35	APN	7	16497655	makesense	probably null
PIT4382001:Arhgap35	UTSW	7	16563869	missense	possibly damaging	0.95
PIT4431001:Arhgap35	UTSW	7	16561611	missense	possibly damaging	0.87
R1690:Arhgap35	UTSW	7	16563281	missense	probably damaging	1.00
R1820:Arhgap35	UTSW	7	16561949	missense	possibly damaging	0.92
R2036:Arhgap35	UTSW	7	16563133	missense	probably damaging	1.00
R2205:Arhgap35	UTSW	7	16498025	splice site	probably null
R2292:Arhgap35	UTSW	7	16563551	missense	probably damaging	1.00
R3079:Arhgap35	UTSW	7	16562576	missense	probably damaging	1.00
R3745:Arhgap35	UTSW	7	16563722	missense	probably damaging	1.00
R3762:Arhgap35	UTSW	7	16565075	missense	probably damaging	0.98
R4661:Arhgap35	UTSW	7	16564738	missense	probably damaging	1.00
R4709:Arhgap35	UTSW	7	16563586	missense	probably damaging	0.97
R4749:Arhgap35	UTSW	7	16498626	missense	possibly damaging	0.95
R5081:Arhgap35	UTSW	7	16565134	missense	possibly damaging	0.71
R5131:Arhgap35	UTSW	7	16511187	splice site	probably null
R5175:Arhgap35	UTSW	7	16562599	missense	probably damaging	1.00
R5440:Arhgap35	UTSW	7	16562924	missense	probably damaging	1.00
R5517:Arhgap35	UTSW	7	16563489	missense	probably damaging	1.00
R5987:Arhgap35	UTSW	7	16563467	missense	possibly damaging	0.84
R6087:Arhgap35	UTSW	7	16563643	missense	probably damaging	1.00
R6139:Arhgap35	UTSW	7	16563467	missense	possibly damaging	0.84
R6396:Arhgap35	UTSW	7	16562299	missense	probably damaging	0.99
R6878:Arhgap35	UTSW	7	16565113	missense	probably benign	0.00
R7063:Arhgap35	UTSW	7	16565113	missense	probably benign	0.00
R7150:Arhgap35	UTSW	7	16562566	missense	probably damaging	0.96
R7269:Arhgap35	UTSW	7	16561727	missense	probably benign
R7276:Arhgap35	UTSW	7	16564568	missense	probably damaging	1.00
R7517:Arhgap35	UTSW	7	16562207	missense	probably benign	0.31
R7593:Arhgap35	UTSW	7	16564861	missense	probably damaging	1.00
R7775:Arhgap35	UTSW	7	16562648	missense	probably benign	0.01
R7792:Arhgap35	UTSW	7	16561528	missense	possibly damaging	0.88
R8101:Arhgap35	UTSW	7	16562319	missense	probably benign	0.00
R8873:Arhgap35	UTSW	7	16561490	missense	possibly damaging	0.92
R8956:Arhgap35	UTSW	7	16614479	start gained	probably benign
R9163:Arhgap35	UTSW	7	16561624	missense	possibly damaging	0.94
R9507:Arhgap35	UTSW	7	16563418	missense	probably benign	0.31
R9667:Arhgap35	UTSW	7	16562989	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAACCATTACCACTGCCATTGGAC -3'
(R):5'- TTCGGGAAGATGCGACATTGCC -3'

Sequencing Primer
(F):5'- CGAATGGTAATGATCTTGCCC -3'
(R):5'- GCCCTCCCTGTCCAAAG -3'

Posted On

2013-05-09