Incidental Mutation 'R4435:Nedd4l'
ID329506
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 041149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4435 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65212825 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 816 (D816G)
Ref Sequence ENSEMBL: ENSMUSP00000153052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080418
AA Change: D836G

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: D836G

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163516
AA Change: D957G

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: D957G

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224347
AA Change: D816G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect possibly damaging
Transcript: ENSMUST00000226058
AA Change: D836G

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Arap1 C A 7: 101,390,254 R574S possibly damaging Het
Arhgap25 T C 6: 87,462,938 I576V possibly damaging Het
Ascc3 T A 10: 50,721,885 V1283D probably benign Het
Asnsd1 A T 1: 53,348,073 probably null Het
Asrgl1 C T 19: 9,119,199 V125I probably damaging Het
Bccip A G 7: 133,719,213 R239G probably benign Het
Cdyl T C 13: 35,858,250 probably null Het
Cyfip1 T C 7: 55,900,041 I650T probably damaging Het
Dennd4c C A 4: 86,798,075 Q506K probably benign Het
Fam135b T C 15: 71,448,739 D1313G probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Gm5134 T G 10: 75,995,824 S366A probably damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hk1 A G 10: 62,275,844 Y713H probably damaging Het
Ifih1 A G 2: 62,645,890 L14P probably damaging Het
Kmt2c A T 5: 25,314,877 N2078K possibly damaging Het
Maf T A 8: 115,706,853 E4V unknown Het
Mbtd1 T A 11: 93,932,222 D489E probably benign Het
Myrip C T 9: 120,335,614 probably benign Het
Nwd1 T C 8: 72,688,136 V934A possibly damaging Het
Olfr290 A G 7: 84,916,021 M81V probably benign Het
Olfr446 T A 6: 42,928,089 I286N probably damaging Het
Psd A T 19: 46,314,494 I158N probably damaging Het
Ptprq A G 10: 107,685,055 V752A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Senp2 T A 16: 22,014,241 V93E possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Slc38a4 T C 15: 97,009,018 S280G probably benign Het
Sos2 T C 12: 69,614,699 E666G possibly damaging Het
Strip2 T C 6: 29,925,050 V129A probably benign Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Ttn T C 2: 76,916,875 E4610G probably benign Het
Uimc1 T C 13: 55,075,823 E212G probably damaging Het
Zc3h18 T C 8: 122,413,952 probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense probably benign
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTGGATAATAAAATGCGACTG -3'
(R):5'- CCAGTTGAGAATTGGCGGTG -3'

Sequencing Primer
(F):5'- AAAATGCGACTGTCTTCTTAATTCCC -3'
(R):5'- TGGCGGAACTTGGGCAG -3'
Posted On2015-07-21