Incidental Mutation 'R4436:Mrvi1'
ID329528
Institutional Source Beutler Lab
Gene Symbol Mrvi1
Ensembl Gene ENSMUSG00000005611
Gene NameMRV integration site 1
SynonymsRis1
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110868266-110982461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110876917 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 815 (E815G)
Ref Sequence ENSEMBL: ENSMUSP00000114578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000127935]
Predicted Effect probably damaging
Transcript: ENSMUST00000005751
AA Change: E750G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611
AA Change: E750G

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125758
AA Change: E815G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611
AA Change: E815G

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127935
AA Change: E609G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120045
Gene: ENSMUSG00000005611
AA Change: E609G

DomainStartEndE-ValueType
Pfam:MRVI1 124 715 7.9e-228 PFAM
Meta Mutation Damage Score 0.1455 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Mrvi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Mrvi1 APN 7 110945967 missense possibly damaging 0.64
IGL01384:Mrvi1 APN 7 110926501 missense possibly damaging 0.89
IGL01474:Mrvi1 APN 7 110871433 missense possibly damaging 0.65
IGL02081:Mrvi1 APN 7 110924074 critical splice acceptor site probably null
IGL02193:Mrvi1 APN 7 110898955 missense probably damaging 1.00
IGL02537:Mrvi1 APN 7 110871473 nonsense probably null
IGL03084:Mrvi1 APN 7 110885829 splice site probably benign
IGL03264:Mrvi1 APN 7 110926346 missense probably benign 0.00
hurricane UTSW 7 110923963 missense probably benign 0.09
R0346:Mrvi1 UTSW 7 110898976 missense probably damaging 1.00
R0401:Mrvi1 UTSW 7 110876897 missense probably benign 0.09
R0731:Mrvi1 UTSW 7 110876900 missense probably benign 0.00
R1168:Mrvi1 UTSW 7 110895931 missense probably damaging 1.00
R1342:Mrvi1 UTSW 7 110888045 missense probably benign 0.07
R1887:Mrvi1 UTSW 7 110924533 critical splice donor site probably null
R2183:Mrvi1 UTSW 7 110898982 missense probably damaging 1.00
R3417:Mrvi1 UTSW 7 110876954 missense possibly damaging 0.90
R3736:Mrvi1 UTSW 7 110923963 missense probably benign 0.09
R4063:Mrvi1 UTSW 7 110923777 missense probably benign 0.38
R4523:Mrvi1 UTSW 7 110923841 missense probably benign 0.02
R4948:Mrvi1 UTSW 7 110888029 missense probably damaging 1.00
R5070:Mrvi1 UTSW 7 110925312 missense probably benign
R5085:Mrvi1 UTSW 7 110871493 missense probably damaging 1.00
R5605:Mrvi1 UTSW 7 110946002 missense possibly damaging 0.85
R6194:Mrvi1 UTSW 7 110899694 missense probably damaging 1.00
R6218:Mrvi1 UTSW 7 110876905 missense probably benign 0.00
R6273:Mrvi1 UTSW 7 110871583 missense probably benign 0.01
R6608:Mrvi1 UTSW 7 110888551 missense probably damaging 1.00
R6754:Mrvi1 UTSW 7 110929512 missense probably damaging 1.00
R6835:Mrvi1 UTSW 7 110921334 missense probably damaging 1.00
R7064:Mrvi1 UTSW 7 110895854 missense probably damaging 1.00
R7304:Mrvi1 UTSW 7 110899724 missense possibly damaging 0.77
R7412:Mrvi1 UTSW 7 110923756 missense probably benign 0.06
R7420:Mrvi1 UTSW 7 110871473 nonsense probably null
X0065:Mrvi1 UTSW 7 110924044 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAGAATTTGAGTTCTGTTGGCCAAG -3'
(R):5'- TCCTGTTGTATGGAGCCACAG -3'

Sequencing Primer
(F):5'- AATTTGGGCCCCAGACCTACTG -3'
(R):5'- CACAGGAAGTGCGCAGTGAC -3'
Posted On2015-07-21