Incidental Mutation 'R4436:Tubd1'
ID329541
Institutional Source Beutler Lab
Gene Symbol Tubd1
Ensembl Gene ENSMUSG00000020513
Gene Nametubulin, delta 1
Synonyms4930550G19Rik
MMRRC Submission 041702-MU
Accession Numbers

Ncbi RefSeq: NM_001199045.1, NM_019756.3, NM_001199046.1, NM_001199047.1; MGI:1891826

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86544991-86567360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86548919 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 30 (S30F)
Ref Sequence ENSEMBL: ENSMUSP00000103665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020821] [ENSMUST00000058286] [ENSMUST00000069503] [ENSMUST00000108030] [ENSMUST00000138810] [ENSMUST00000154617] [ENSMUST00000167178]
Predicted Effect probably benign
Transcript: ENSMUST00000020821
AA Change: S30F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020821
Gene: ENSMUSG00000020513
AA Change: S30F

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020824
Predicted Effect probably benign
Transcript: ENSMUST00000058286
SMART Domains Protein: ENSMUSP00000053188
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
Pfam:Pkinase 91 202 1.2e-19 PFAM
Pfam:Pkinase_Tyr 91 253 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069503
AA Change: S30F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000064383
Gene: ENSMUSG00000020513
AA Change: S30F

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108030
AA Change: S30F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103665
Gene: ENSMUSG00000020513
AA Change: S30F

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138810
SMART Domains Protein: ENSMUSP00000122756
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
SCOP:d1koba_ 13 74 9e-13 SMART
PDB:4L3L|A 21 74 6e-30 PDB
Blast:S_TKc 38 74 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154617
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167178
AA Change: S30F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130909
Gene: ENSMUSG00000020513
AA Change: S30F

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Tubd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tubd1 APN 11 86565729 missense probably benign 0.07
IGL00465:Tubd1 APN 11 86555068 splice site probably benign
IGL03088:Tubd1 APN 11 86552999 missense probably damaging 1.00
IGL03383:Tubd1 APN 11 86549008 splice site probably benign
R0039:Tubd1 UTSW 11 86549395 nonsense probably null
R0427:Tubd1 UTSW 11 86557790 missense possibly damaging 0.94
R0482:Tubd1 UTSW 11 86557776 missense possibly damaging 0.89
R2305:Tubd1 UTSW 11 86555191 missense probably benign 0.38
R4153:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
R4773:Tubd1 UTSW 11 86555302 missense possibly damaging 0.83
R4793:Tubd1 UTSW 11 86567069 missense probably benign 0.19
R4890:Tubd1 UTSW 11 86552795 missense possibly damaging 0.83
R4908:Tubd1 UTSW 11 86567053 missense probably damaging 1.00
R4990:Tubd1 UTSW 11 86557839 missense probably damaging 1.00
R5004:Tubd1 UTSW 11 86561320 missense probably damaging 0.98
R6192:Tubd1 UTSW 11 86557793 missense probably benign 0.32
R7108:Tubd1 UTSW 11 86557805 missense probably damaging 0.99
Z1088:Tubd1 UTSW 11 86555167 missense probably damaging 1.00
Z1088:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
Z1176:Tubd1 UTSW 11 86549405 missense possibly damaging 0.94
Z1177:Tubd1 UTSW 11 86552898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAGAATGTGAGCATGTGGC -3'
(R):5'- CAAACCGCAGCATGGAGTAG -3'

Sequencing Primer
(F):5'- AGCAATGTGGTGGTTTCTCATGTC -3'
(R):5'- CCGCAGCATGGAGTAGG -3'
Posted On2015-07-21